NM_001319206.4:c.1262_1285delAGCAGCAGCAGCAGCAGCAGCAGC

Variant names:

• chr15-99712504-CCAGCAGCAGCAGCAGCAGCAGCAG-C
• rs3138597
• NM_001319206.4:c.1262_1285delAGCAGCAGCAGCAGCAGCAGCAGC

Variant summary

Our verdict is Likely benign. Variant got -1 ACMG points: 0P and 1B. BS2_Supporting

The NM_001319206.4(MEF2A):​c.1262_1285delAGCAGCAGCAGCAGCAGCAGCAGC​(p.Gln421_Gln428del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.0000116 in 1,381,130 control chromosomes in the GnomAD database, with no homozygous occurrence. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: not found (cov: 0)
  • Exomes 𝑓: 0.000012 (0 hom.)
• Consequence: MEF2A NM_001319206.4 disruptive_inframe_deletion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 6.73

Genes affected

MEF2A (HGNC:6993): (myocyte enhancer factor 2A) The protein encoded by this gene is a DNA-binding transcription factor that activates many muscle-specific, growth factor-induced, and stress-induced genes. The encoded protein can act as a homodimer or as a heterodimer and is involved in several cellular processes, including muscle development, neuronal differentiation, cell growth control, and apoptosis. Defects in this gene could be a cause of autosomal dominant coronary artery disease 1 with myocardial infarction (ADCAD1). Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jan 2010]

ACMG classification

Verdict is Likely_benign. Variant got -1 ACMG points.

• BS2: High AC in GnomAdExome4 at 16 AD gene. Variant has AC lower than other variant known as pathogenic in the gene, so the strength is limited to Supporting.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MEF2A	NM_001319206.4	c.1262_1285delAGCAGCAGCAGCAGCAGCAGCAGC	p.Gln421_Gln428del	disruptive_inframe_deletion	Exon 12 of 12	ENST00000557942.6	NP_001306135.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MEF2A	ENST00000557942.6	c.1262_1285delAGCAGCAGCAGCAGCAGCAGCAGC	p.Gln421_Gln428del	disruptive_inframe_deletion	Exon 12 of 12	5	NM_001319206.4	ENSP00000453095.1

Frequencies

GnomAD3 genomes Cov.: 0

GnomAD4 exome AF: 0.0000116 AC: 16 AN: 1381130 Hom.: 0 AF XY: 0.0000103 AC XY: 7 AN XY: 681108

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.000114

Gnomad4 SAS exome AF: 0.0000256

Gnomad4 FIN exome AF: 0.0000209

Gnomad4 NFE exome AF: 0.00000751

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 0

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs3138597; hg19: chr15-100252709;