NM_001369.3:c.7468_7488delTGGAGCGCGGGGGCGGCGCTG

Variant names:

• chr5-13810179-CCAGCGCCGCCCCCGCGCTCCA-C
• rs727502975
• NM_001369.3:c.7468_7488delTGGAGCGCGGGGGCGGCGCTG

Variant summary

Our verdict is Uncertain significance. The variant received 5 ACMG points: 5P and 0B. PM4 PP3 PP5_Moderate

The NM_001369.3(DNAH5):​c.7468_7488delTGGAGCGCGGGGGCGGCGCTG​(p.Trp2490_Leu2496del) variant causes a conservative inframe deletion change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.000011 in 1,548,990 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★).

• Frequency:
  • Genomes: 𝑓 0.0000066 (0 hom., cov: 32)
  • Exomes 𝑓: 0.000011 (0 hom.)
• Consequence: DNAH5 NM_001369.3 conservative_inframe_deletion
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 9.90
• Publications: 0 publications found

Genes affected

DNAH5 (HGNC:2950): (dynein axonemal heavy chain 5) This gene encodes a dynein protein, which is part of a microtubule-associated motor protein complex consisting of heavy, light, and intermediate chains. This protein is an axonemal heavy chain dynein. It functions as a force-generating protein with ATPase activity, whereby the release of ADP is thought to produce the force-producing power stroke. Mutations in this gene cause primary ciliary dyskinesia type 3, as well as Kartagener syndrome, which are both diseases due to ciliary defects. [provided by RefSeq, Oct 2009]

DNAH5 Gene-Disease associations (from GenCC):

• primary ciliary dyskinesia 3

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: PanelApp Australia, Labcorp Genetics (formerly Invitae), G2P, ClinGen
• primary ciliary dyskinesia

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 5 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_001369.3.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 5-13810179-CCAGCGCCGCCCCCGCGCTCCA-C is Pathogenic according to our data. Variant chr5-13810179-CCAGCGCCGCCCCCGCGCTCCA-C is described in ClinVar as Likely_pathogenic. ClinVar VariationId is 163141.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001369.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	DNAH5	NM_001369.3	MANE Select	c.7468_7488delTGGAGCGCGGGGGCGGCGCTG	p.Trp2490_Leu2496del	conservative_inframe_deletion	Exon 45 of 79	NP_001360.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	DNAH5	ENST00000265104.5	TSL:1 MANE Select	c.7468_7488delTGGAGCGCGGGGGCGGCGCTG	p.Trp2490_Leu2496del	conservative_inframe_deletion	Exon 45 of 79	ENSP00000265104.4
	DNAH5	ENST00000681290.1		c.7423_7443delTGGAGCGCGGGGGCGGCGCTG	p.Trp2475_Leu2481del	conservative_inframe_deletion	Exon 45 of 79	ENSP00000505288.1
	DNAH5	ENST00000512443.1	TSL:3	n.324_344delTGGAGCGCGGGGGCGGCGCTG		non_coding_transcript_exon	Exon 1 of 3

Frequencies

GnomAD3 genomes AF: 0.00000657 AC: 1 AN: 152222 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000147

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.0000115 AC: 16 AN: 1396768 Hom.: 0 AF XY: 0.00000871 AC XY: 6 AN XY: 688820

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 31530

American (AMR) AF: 0.00 AC: 0 AN: 35620

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 25104

East Asian (EAS) AF: 0.00 AC: 0 AN: 35690

South Asian (SAS) AF: 0.00 AC: 0 AN: 79142

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 48156

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5674

European-Non Finnish (NFE) AF: 0.0000148 AC: 16 AN: 1077962

Other (OTH) AF: 0.00 AC: 0 AN: 57890

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.00000000000996614), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.00000657 AC: 1 AN: 152222 Hom.: 0 Cov.: 32 AF XY: 0.00 AC XY: 0 AN XY: 74360

African (AFR) AF: 0.00 AC: 0 AN: 41470

American (AMR) AF: 0.00 AC: 0 AN: 15286

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3472

East Asian (EAS) AF: 0.00 AC: 0 AN: 5180

South Asian (SAS) AF: 0.00 AC: 0 AN: 4836

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10628

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 314

European-Non Finnish (NFE) AF: 0.0000147 AC: 1 AN: 68030

Other (OTH) AF: 0.00 AC: 0 AN: 2094

ClinVar

ClinVar submissions as Germline

Significance: Likely pathogenic

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
1	-	-	Primary ciliary dyskinesia (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.9
Mutation Taster		=11/189	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs727502975; hg19: chr5-13810288;