NM_001385641.1:c.610-23_610-3delTTCCTCTCCTCCTGCCCCACC

Variant names:

• chr1-930081-AGCCCCACCTTCCTCTCCTCCT-A
• rs879326979
• NM_001385641.1:c.610-23_610-3delTTCCTCTCCTCCTGCCCCACC

Variant summary

Our verdict is Likely benign. Variant got -5 ACMG points: 0P and 5B. BP6 BS2

The NM_001385641.1(SAMD11):​c.610-23_610-3delTTCCTCTCCTCCTGCCCCACC variant causes a splice region, intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000889 in 1,475,018 control chromosomes in the GnomAD database, including 4 homozygotes. Variant has been reported in ClinVar as Likely benign (no stars).

• Frequency:
  • Genomes: 𝑓 0.0022 (1 hom., cov: 33)
  • Exomes 𝑓: 0.00074 (3 hom.)
• Consequence: SAMD11 NM_001385641.1 splice_region, intron
• Clinical Significance: Likely benign no assertion criteria provided B:1
• Conservation: PhyloP100: 1.35

Genes affected

SAMD11 (HGNC:28706): (sterile alpha motif domain containing 11) Predicted to enable several functions, including histone binding activity; protein domain specific binding activity; and protein self-association. Predicted to be involved in negative regulation of transcription, DNA-templated. Predicted to act upstream of or within negative regulation of transcription by RNA polymerase II. Predicted to be active in nucleus. [provided by Alliance of Genome Resources, Apr 2022]

ACMG classification

Verdict is Likely_benign. Variant got -5 ACMG points.

• BP6: Variant 1-930081-AGCCCCACCTTCCTCTCCTCCT-A is Benign according to our data. Variant chr1-930081-AGCCCCACCTTCCTCTCCTCCT-A is described in ClinVar as [Likely_benign]. Clinvar id is 3038970.Status of the report is no_assertion_criteria_provided, 0 stars.
• BS2: High Homozygotes in GnomAdExome4 at 3 AR gene

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
SAMD11	NM_001385641.1	c.610-23_610-3delTTCCTCTCCTCCTGCCCCACC		splice_region_variant, intron_variant	Intron 2 of 13	ENST00000616016.5	NP_001372570.1
SAMD11	NM_001385640.1	c.610-23_610-3delTTCCTCTCCTCCTGCCCCACC		splice_region_variant, intron_variant	Intron 2 of 13		NP_001372569.1
SAMD11	NM_152486.4	c.73-23_73-3delTTCCTCTCCTCCTGCCCCACC		splice_region_variant, intron_variant	Intron 2 of 13		NP_689699.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
SAMD11	ENST00000616016.5	c.610-73_610-53delGCCCCACCTTCCTCTCCTCCT		intron_variant	Intron 2 of 13	5	NM_001385641.1	ENSP00000478421.2

Frequencies

GnomAD3 genomes AF: 0.00219 AC: 332 AN: 151426 Hom.: 1 Cov.: 33

Gnomad AFR AF: 0.00581

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00125

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00233

Gnomad SAS AF: 0.00147

Gnomad FIN AF: 0.00142

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000590

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.000737 AC: 975 AN: 1323474 Hom.: 3 AF XY: 0.000789 AC XY: 511 AN XY: 647992

Gnomad4 AFR exome AF: 0.00334

Gnomad4 AMR exome AF: 0.000618

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00588

Gnomad4 SAS exome AF: 0.000706

Gnomad4 FIN exome AF: 0.00261

Gnomad4 NFE exome AF: 0.000411

Gnomad4 OTH exome AF: 0.00102

GnomAD4 genome AF: 0.00222 AC: 337 AN: 151544 Hom.: 1 Cov.: 33 AF XY: 0.00209 AC XY: 155 AN XY: 74028

Gnomad4 AFR AF: 0.00591

Gnomad4 AMR AF: 0.00125

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00234

Gnomad4 SAS AF: 0.00147

Gnomad4 FIN AF: 0.00142

Gnomad4 NFE AF: 0.000590

Gnomad4 OTH AF: 0.00

Alfa AF: 0.00153 Hom.: 0

ClinVar

Significance: Likely benign

Submissions summary: Benign:1

Revision: no assertion criteria provided

Submissions by phenotype

SAMD11-related disorder Benign:1

May 28, 2019

PreventionGenetics, part of Exact Sciences

Significance: Likely benign

Review Status: no assertion criteria provided

Collection Method: clinical testing

This variant is classified as likely benign based on ACMG/AMP sequence variant interpretation guidelines (Richards et al. 2015 PMID: 25741868, with internal and published modifications). -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs879326979; hg19: chr1-865461;