NM_002139.4:c.1037_1059delAAAGAGGGCTTCCCCCTTCTATG
Variant summary
Our verdict is Uncertain significance. The variant received 1 ACMG points: 1P and 0B. PP5
The NM_002139.4(RBMX):c.1037_1059delAAAGAGGGCTTCCCCCTTCTATG(p.Glu346GlyfsTer9) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars).
Frequency
Consequence
NM_002139.4 frameshift
Scores
Clinical Significance
Conservation
Publications
- syndromic X-linked intellectual disability Shashi typeInheritance: Unknown, XL Classification: MODERATE, LIMITED Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 1 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_002139.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| RBMX | MANE Select | c.1037_1059delAAAGAGGGCTTCCCCCTTCTATG | p.Glu346GlyfsTer9 | frameshift | Exon 9 of 9 | NP_002130.2 | P38159-1 | ||
| RBMX | c.540+805_540+827delAAAGAGGGCTTCCCCCTTCTATG | intron | N/A | NP_001158275.1 | P38159-3 | ||||
| RBMX | n.1020_1042delAAAGAGGGCTTCCCCCTTCTATG | non_coding_transcript_exon | Exon 8 of 8 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| RBMX | TSL:1 MANE Select | c.1037_1059delAAAGAGGGCTTCCCCCTTCTATG | p.Glu346GlyfsTer9 | frameshift | Exon 9 of 9 | ENSP00000359645.3 | P38159-1 | ||
| RBMX | TSL:1 | c.*779_*801delAAAGAGGGCTTCCCCCTTCTATG | 3_prime_UTR | Exon 8 of 8 | ENSP00000457051.1 | H3BT71 | |||
| RBMX | TSL:1 | n.*1261_*1283delAAAGAGGGCTTCCCCCTTCTATG | non_coding_transcript_exon | Exon 7 of 8 | ENSP00000457691.1 | H3BR27 |
Frequencies
GnomAD3 genomes Cov.: 34
GnomAD4 genome Cov.: 34
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at