NM_003070.5:c.678_707delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA
Variant summary
Our verdict is Likely benign. The variant received -3 ACMG points: 0P and 3B. BP3BP6_Moderate
The NM_003070.5(SMARCA2):c.678_707delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA(p.Gln227_Gln236del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000266 in 150,532 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★). Synonymous variant affecting the same amino acid position (i.e. Q226Q) has been classified as Likely benign.
Frequency
Consequence
NM_003070.5 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- intellectual disability-sparse hair-brachydactyly syndromeInheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, G2P, Ambry Genetics, Labcorp Genetics (formerly Invitae), ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -3 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| SMARCA2 | NM_003070.5 | c.678_707delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA | p.Gln227_Gln236del | disruptive_inframe_deletion | Exon 4 of 34 | ENST00000349721.8 | NP_003061.3 | |
| SMARCA2 | NM_001289396.2 | c.678_707delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA | p.Gln227_Gln236del | disruptive_inframe_deletion | Exon 4 of 34 | NP_001276325.1 | ||
| SMARCA2 | NM_139045.4 | c.678_707delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA | p.Gln227_Gln236del | disruptive_inframe_deletion | Exon 4 of 33 | NP_620614.2 | ||
| SMARCA2 | NM_001289397.2 | c.678_707delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA | p.Gln227_Gln236del | disruptive_inframe_deletion | Exon 4 of 33 | NP_001276326.1 |
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| SMARCA2 | ENST00000349721.8 | c.678_707delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA | p.Gln227_Gln236del | disruptive_inframe_deletion | Exon 4 of 34 | 5 | NM_003070.5 | ENSP00000265773.5 |
Frequencies
GnomAD3 genomes AF: 0.0000332 AC: 5AN: 150432Hom.: 0 Cov.: 26 show subpopulations
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000885 AC: 128AN: 1445816Hom.: 0 AF XY: 0.0000738 AC XY: 53AN XY: 718568 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.0000266 AC: 4AN: 150532Hom.: 0 Cov.: 26 AF XY: 0.0000272 AC XY: 2AN XY: 73486 show subpopulations
Age Distribution
ClinVar
Submissions by phenotype
not provided Benign:1
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at