NM_003106.4:c.70_89delAACTCCACCGCGGCGGCGGC
Variant summary
Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The NM_003106.4(SOX2):c.70_89delAACTCCACCGCGGCGGCGGC(p.Asn24ArgfsTer65) variant causes a frameshift change. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★).
Frequency
Consequence
NM_003106.4 frameshift
Scores
Clinical Significance
Conservation
Publications
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 16 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_003106.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| SOX2 | MANE Select | c.70_89delAACTCCACCGCGGCGGCGGC | p.Asn24ArgfsTer65 | frameshift | Exon 1 of 1 | NP_003097.1 | P48431 | ||
| SOX2-OT | n.768-2755_768-2736delAACTCCACCGCGGCGGCGGC | intron | N/A | ||||||
| SOX2-OT | n.767+12547_767+12566delAACTCCACCGCGGCGGCGGC | intron | N/A |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| SOX2 | TSL:6 MANE Select | c.70_89delAACTCCACCGCGGCGGCGGC | p.Asn24ArgfsTer65 | frameshift | Exon 1 of 1 | ENSP00000323588.1 | P48431 | ||
| SOX2-OT | TSL:1 | n.349+12547_349+12566delAACTCCACCGCGGCGGCGGC | intron | N/A | |||||
| SOX2-OT | TSL:1 | n.482-27139_482-27120delAACTCCACCGCGGCGGCGGC | intron | N/A |
Frequencies
GnomAD3 genomes AF: 0.00 AC: 0AN: 150922Hom.: 0 Cov.: 32
GnomAD4 genome Data not reliable, filtered out with message: AC0 AF: 0.00 AC: 0AN: 150922Hom.: 0 Cov.: 32 AF XY: 0.00 AC XY: 0AN XY: 73682
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at