NM_003401.5:c.315+31120_315+31149delGATGAGGAAACTAACTCTCAGTGGTGTTTA

Variant names:

• chr5-83142292-GGATGAGGAAACTAACTCTCAGTGGTGTTTA-G
• rs28360071
• NM_003401.5:c.315+31120_315+31149delGATGAGGAAACTAACTCTCAGTGGTGTTTA

Variant summary

Our verdict is Benign. The variant received -8 ACMG points: 0P and 8B. BA1

The NM_003401.5(XRCC4):​c.315+31120_315+31149delGATGAGGAAACTAACTCTCAGTGGTGTTTA variant causes a intron change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: 𝑓 0.48 (18197 hom., cov: 0)
• Consequence: XRCC4 NM_003401.5 intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 1.96
• Publications: 34 publications found

Genes affected

XRCC4 (HGNC:12831): (X-ray repair cross complementing 4) The protein encoded by this gene functions together with DNA ligase IV and the DNA-dependent protein kinase in the repair of DNA double-strand breaks. This protein plays a role in both non-homologous end joining and the completion of V(D)J recombination. Mutations in this gene can cause short stature, microcephaly, and endocrine dysfunction (SSMED). Alternate transcript variants such as NM_022406 are unlikely to be expressed in some individuals due to a polymorphism (rs1805377) in the last splice acceptor site. [provided by RefSeq, Oct 2019]

XRCC4 Gene-Disease associations (from GenCC):

• short stature, microcephaly, and endocrine dysfunction

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P, Laboratory for Molecular Medicine
• microcephalic primordial dwarfism-insulin resistance syndrome

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• hereditary nonpolyposis colon cancer

  Inheritance: AD Classification: LIMITED Submitted by: ClinGen

ACMG classification

Our verdict: Benign. The variant received -8 ACMG points.

• BA1: GnomAd4 highest subpopulation (AFR) allele frequency at 95% confidence interval = 0.619 is higher than 0.05.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
XRCC4	NM_003401.5	c.315+31120_315+31149delGATGAGGAAACTAACTCTCAGTGGTGTTTA		intron_variant	Intron 3 of 7	ENST00000396027.9	NP_003392.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
XRCC4	ENST00000396027.9	c.315+31090_315+31119delGATGAGGAAACTAACTCTCAGTGGTGTTTA		intron_variant	Intron 3 of 7	5	NM_003401.5	ENSP00000379344.4

Frequencies

GnomAD3 genomes AF: 0.480 AC: 72075 AN: 150198 Hom.: 18182 Cov.: 0

Gnomad AFR AF: 0.626

Gnomad AMI AF: 0.506

Gnomad AMR AF: 0.340

Gnomad ASJ AF: 0.377

Gnomad EAS AF: 0.203

Gnomad SAS AF: 0.513

Gnomad FIN AF: 0.480

Gnomad MID AF: 0.411

Gnomad NFE AF: 0.449

Gnomad OTH AF: 0.446

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome AF: 0.480 AC: 72117 AN: 150308 Hom.: 18197 Cov.: 0 AF XY: 0.479 AC XY: 35135 AN XY: 73372

African (AFR) AF: 0.625 AC: 25477 AN: 40736

American (AMR) AF: 0.339 AC: 5144 AN: 15166

Ashkenazi Jewish (ASJ) AF: 0.377 AC: 1303 AN: 3456

East Asian (EAS) AF: 0.202 AC: 1043 AN: 5154

South Asian (SAS) AF: 0.511 AC: 2416 AN: 4726

European-Finnish (FIN) AF: 0.480 AC: 4982 AN: 10372

Middle Eastern (MID) AF: 0.394 AC: 115 AN: 292

European-Non Finnish (NFE) AF: 0.449 AC: 30250 AN: 67414

Other (OTH) AF: 0.446 AC: 935 AN: 2098

Alfa AF: 0.464 Hom.: 1847

Asia WGS AF: 0.372 AC: 1293 AN: 3478

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.0
Mutation Taster		=100/0	polymorphism (auto)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs28360071; hg19: chr5-82438111;