NM_004260.4:c.3394C>T

Variant names:

• chr8-144511789-G-A
• rs1554895894
• NM_004260.4:c.3394C>T

Variant summary

Our verdict is Uncertain significance. The variant received 3 ACMG points: 4P and 1B. PM2 PM5 BP4

The NM_004260.4(RECQL4):​c.3394C>T​(p.Leu1132Phe) variant causes a missense, splice region change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. In-silico tool predicts a benign outcome for this variant. 12/16 in silico tools predict a benign outcome for this variant. 3/3 splice prediction tools predict no significant impact on normal splicing. Variant has been reported in ClinVar as Uncertain significance (★). Another variant affecting the same amino acid position, but resulting in a different missense has been classified as Likely pathogenic.

• Frequency: Genomes: not found (cov: 34)
• Consequence: RECQL4 NM_004260.4 missense, splice_region
• Scores: Splicing: ADA: 0.00009513
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 0.568
• Publications: 0 publications found

Genes affected

RECQL4 (HGNC:9949): (RecQ like helicase 4) The protein encoded by this gene is a DNA helicase that belongs to the RecQ helicase family. DNA helicases unwind double-stranded DNA into single-stranded DNAs and may modulate chromosome segregation. This gene is predominantly expressed in thymus and testis. Mutations in this gene are associated with Rothmund-Thomson, RAPADILINO and Baller-Gerold syndromes. [provided by RefSeq, Jan 2010]

RECQL4 Gene-Disease associations (from GenCC):

• Baller-Gerold syndrome

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: PanelApp Australia, G2P, Orphanet
• Rothmund-Thomson syndrome

  Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
• Rothmund-Thomson syndrome type 2

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet, Genomics England PanelApp, G2P
• osteosarcoma

  Inheritance: AR Classification: STRONG Submitted by: Genomics England PanelApp
• rapadilino syndrome

  Inheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Genomics England PanelApp

ACMG classification

Our verdict: Uncertain_significance. The variant received 3 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM5: Other missense variant is known to change same aminoacid residue: Variant chr8-144511722-TTCTCCTCTGGCCTCAGGGACAGGAACTGGCGGATGTCGCAGCGGACCTGGTCCTCCCAATCCTGGAGCTGTGTGGACAGGCACATCAGGCTTCCTCTGAGCTCCCGTGGCACTGCATCCACAGAGCAA-CT is described in ClinVar as Likely_pathogenic. ClinVar VariationId is 2030135.Status of the report is criteria_provided_single_submitter, 1 stars.
• BP4: Computational evidence support a benign effect (MetaRNN=0.29189014).

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
RECQL4	NM_004260.4	c.3394C>T	p.Leu1132Phe	missense_variant, splice_region_variant	Exon 20 of 21	ENST00000617875.6	NP_004251.4

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
RECQL4	ENST00000617875.6	c.3394C>T	p.Leu1132Phe	missense_variant, splice_region_variant	Exon 20 of 21	1	NM_004260.4	ENSP00000482313.2

Frequencies

GnomAD3 genomes Cov.: 34

GnomAD4 exome Cov.: 36

GnomAD4 genome Cov.: 34

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Baller-Gerold syndrome Uncertain:1

Aug 16, 2017

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change replaces leucine with phenylalanine at codon 1132 of the RECQL4 protein (p.Leu1132Phe). The leucine residue is highly conserved and there is a small physicochemical difference between leucine and phenylalanine. This variant is not present in population databases (ExAC no frequency). This variant has not been reported in the literature in individuals with RECQL4-related disease. Algorithms developed to predict the effect of missense changes on protein structure and function (SIFT, PolyPhen-2, Align-GVGD) all suggest that this variant is likely to be tolerated, but these predictions have not been confirmed by published functional studies and their clinical significance is uncertain. Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant is not likely to affect RNA splicing, but this prediction has not been confirmed by published transcriptional studies. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
AlphaMissense	Benign	0.15
BayesDel_addAF	Benign	-0.10	T
BayesDel_noAF	Benign	-0.39
CADD	Benign	18
DANN	Benign	0.86
DEOGEN2	Benign	0.031	T;T;T
FATHMM_MKL	Uncertain	0.95	D
LIST_S2	Benign	0.61	T;T;T
M_CAP	Benign	0.043	D
MetaRNN	Benign	0.21	T;T;T
MutationAssessor	Uncertain	2.8	.;M;.
PhyloP100		0.57
PrimateAI	Benign	0.44	T
Sift4G	Benign	0.26	T;T;T
Polyphen		0.048	.;B;.
Vest4		0.48
MVP		0.45
GERP RS		1.9
Varity_R		0.050
gMVP		0.49
Mutation Taster		=77/23	polymorphism

Splicing

Name	Calibrated prediction	Score	Prediction
dbscSNV1_ADA	Benign	0.000095
dbscSNV1_RF	Benign	0.0
SpliceAI score (max)		0.18		Details are displayed if max score is > 0.2

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1554895894; hg19: chr8-145737172;