NM_004462.5:c.100-81_100-46dupCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC
Variant summary
Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.
The NM_004462.5(FDFT1):c.100-81_100-46dupCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC variant causes a intron change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
NM_004462.5 intron
Scores
Clinical Significance
Conservation
Publications
- retinitis pigmentosaInheritance: AR Classification: LIMITED Submitted by: G2P
- squalene synthase deficiencyInheritance: AR Classification: LIMITED Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), G2P
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 0 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_004462.5. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| FDFT1 | MANE Select | c.100-81_100-46dupCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC | intron | N/A | NP_004453.3 | ||||
| FDFT1 | c.196_231dupCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC | p.His66_Ser77dup | conservative_inframe_insertion | Exon 1 of 7 | NP_001274679.1 | A0A1W2PQ47 | |||
| FDFT1 | c.100-81_100-46dupCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC | intron | N/A | NP_001274671.1 | Q6IAX1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| FDFT1 | TSL:1 MANE Select | c.100-81_100-46dupCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC | intron | N/A | ENSP00000220584.4 | P37268-1 | |||
| FDFT1 | TSL:1 | n.100-954_100-919dupCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC | intron | N/A | ENSP00000434770.1 | E9PNJ2 | |||
| FDFT1 | TSL:2 | c.196_231dupCACTCCCACTCCCACTCCCACTCCCACTCCCACTCC | p.His66_Ser77dup | conservative_inframe_insertion | Exon 1 of 7 | ENSP00000491537.1 | A0A1W2PQ47 |
Frequencies
GnomAD3 genomes AF: 0.000161 AC: 24AN: 148922Hom.: 0 Cov.: 0 show subpopulations
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.000102 AC: 140AN: 1366052Hom.: 3 Cov.: 0 AF XY: 0.000141 AC XY: 95AN XY: 672638 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.000161 AC: 24AN: 148922Hom.: 0 Cov.: 0 AF XY: 0.000124 AC XY: 9AN XY: 72512 show subpopulations
Age Distribution
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at