NM_004606.5:c.4753+12764_4753+12784delAATAATGGCTTCTAGTTTTCT
Variant summary
Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.
The NM_004606.5(TAF1):c.4753+12764_4753+12784delAATAATGGCTTCTAGTTTTCT variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
NM_004606.5 intron
Scores
Clinical Significance
Conservation
Publications
- intellectual disability, X-linked, syndromic 33Inheritance: XL Classification: DEFINITIVE, STRONG Submitted by: G2P, PanelApp Australia, Illumina, Labcorp Genetics (formerly Invitae), Ambry Genetics
- X-linked dystonia-parkinsonismInheritance: XL, Unknown Classification: STRONG, MODERATE, SUPPORTIVE, LIMITED Submitted by: Genomics England PanelApp, PanelApp Australia, Orphanet, Labcorp Genetics (formerly Invitae), Ambry Genetics
- X-linked intellectual disability-global development delay-facial dysmorphism-sacral caudal remnant syndromeInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 0 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_004606.5. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| TAF1 | NM_004606.5 | MANE Select | c.4753+12764_4753+12784delAATAATGGCTTCTAGTTTTCT | intron | N/A | NP_004597.3 | |||
| TAF1 | NM_001286074.2 | c.4753+12764_4753+12784delAATAATGGCTTCTAGTTTTCT | intron | N/A | NP_001273003.2 | ||||
| TAF1 | NM_001440852.1 | c.4753+12764_4753+12784delAATAATGGCTTCTAGTTTTCT | intron | N/A | NP_001427781.1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| TAF1 | ENST00000423759.6 | TSL:5 MANE Select | c.4753+12764_4753+12784delAATAATGGCTTCTAGTTTTCT | intron | N/A | ENSP00000406549.2 | P21675-14 | ||
| TAF1 | ENST00000373790.9 | TSL:1 | c.4690+12764_4690+12784delAATAATGGCTTCTAGTTTTCT | intron | N/A | ENSP00000362895.5 | P21675-13 | ||
| TAF1 | ENST00000437147.8 | TSL:1 | n.712+12764_712+12784delAATAATGGCTTCTAGTTTTCT | intron | N/A | ENSP00000406517.4 | H7C2K9 |
Frequencies
GnomAD3 genomes Cov.: 22
GnomAD4 genome Cov.: 22
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at