NM_005562.3:c.3375_3394delGAAGCTTTCCCGAGCCAAGA

Variant names:

• chr1-183243191-CAGAAGCTTTCCCGAGCCAAG-C
• rs1553267882
• NM_005562.3:c.3375_3394delGAAGCTTTCCCGAGCCAAGA

Variant summary

Our verdict is Likely pathogenic. Variant got 8 ACMG points: 8P and 0B. PVS1_Strong PM2 PP5_Moderate

The NM_005562.3(LAMC2):​c.3375_3394delGAAGCTTTCCCGAGCCAAGA​(p.Gln1125HisfsTer38) variant causes a frameshift change. The variant allele was found at a frequency of 0.000000685 in 1,459,440 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Likely pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. Q1125Q) has been classified as Likely benign.

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 6.9e-7 (0 hom.)
• Consequence: LAMC2 NM_005562.3 frameshift
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 6.77

Genes affected

LAMC2 (HGNC:6493): (laminin subunit gamma 2) Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins, composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively), have a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the gamma chain isoform laminin, gamma 2. The gamma 2 chain, formerly thought to be a truncated version of beta chain (B2t), is highly homologous to the gamma 1 chain; however, it lacks domain VI, and domains V, IV and III are shorter. It is expressed in several fetal tissues but differently from gamma 1, and is specifically localized to epithelial cells in skin, lung and kidney. The gamma 2 chain together with alpha 3 and beta 3 chains constitute laminin 5 (earlier known as kalinin), which is an integral part of the anchoring filaments that connect epithelial cells to the underlying basement membrane. The epithelium-specific expression of the gamma 2 chain implied its role as an epithelium attachment molecule, and mutations in this gene have been associated with junctional epidermolysis bullosa, a skin disease characterized by blisters due to disruption of the epidermal-dermal junction. Two transcript variants resulting from alternative splicing of the 3' terminal exon, and encoding different isoforms of gamma 2 chain, have been described. The two variants are differentially expressed in embryonic tissues, however, the biological significance of the two forms is not known. Transcript variants utilizing alternative polyA_signal have also been noted in literature. [provided by RefSeq, Aug 2011]

ACMG classification

Verdict is Likely_pathogenic. Variant got 8 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. There are 5 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 1-183243191-CAGAAGCTTTCCCGAGCCAAG-C is Pathogenic according to our data. Variant chr1-183243191-CAGAAGCTTTCCCGAGCCAAG-C is described in ClinVar as [Likely_pathogenic]. Clinvar id is 552383.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
LAMC2	NM_005562.3	c.3375_3394delGAAGCTTTCCCGAGCCAAGA	p.Gln1125HisfsTer38	frameshift_variant	Exon 23 of 23	ENST00000264144.5	NP_005553.2
LAMC2	XM_047420358.1	c.3328+2802_3328+2821delGAAGCTTTCCCGAGCCAAGA		intron_variant	Intron 22 of 23		XP_047276314.1
LAMC2	XM_047420361.1	c.3328+2802_3328+2821delGAAGCTTTCCCGAGCCAAGA		intron_variant	Intron 22 of 22		XP_047276317.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
LAMC2	ENST00000264144.5	c.3375_3394delGAAGCTTTCCCGAGCCAAGA	p.Gln1125HisfsTer38	frameshift_variant	Exon 23 of 23	1	NM_005562.3	ENSP00000264144.4
LAMC2	ENST00000476255.1	n.-242_-223delAGAAGCTTTCCCGAGCCAAG		upstream_gene_variant		2

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome AF: 6.85e-7 AC: 1 AN: 1459440 Hom.: 0 AF XY: 0.00000138 AC XY: 1 AN XY: 726052

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.0000116

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 32

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Junctional epidermolysis bullosa gravis of Herlitz Pathogenic:1

Jun 08, 2017

Counsyl

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1553267882; hg19: chr1-183212326;