NM_006218.4:c.29_53delTGTGGGGCATCCACTTGATGCCCCC

Variant names:

• chr3-179198852-ACTGTGGGGCATCCACTTGATGCCCC-A
• rs1560137030
• NM_006218.4:c.29_53delTGTGGGGCATCCACTTGATGCCCCC

Variant summary

Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PVS1

The NM_006218.4(PIK3CA):​c.29_53delTGTGGGGCATCCACTTGATGCCCCC​(p.Leu10GlnfsTer4) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. L10L) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 32)
• Consequence: PIK3CA NM_006218.4 frameshift
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 9.51
• Publications: 0 publications found

Genes affected

PIK3CA (HGNC:8975): (phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit alpha) Phosphatidylinositol 3-kinase is composed of an 85 kDa regulatory subunit and a 110 kDa catalytic subunit. The protein encoded by this gene represents the catalytic subunit, which uses ATP to phosphorylate PtdIns, PtdIns4P and PtdIns(4,5)P2. This gene has been found to be oncogenic and has been implicated in cervical cancers. A pseudogene of this gene has been defined on chromosome 22. [provided by RefSeq, Apr 2016]

PIK3CA Gene-Disease associations (from GenCC):

• overgrowth syndrome and/or cerebral malformations due to abnormalities in MTOR pathway genes

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• megalencephaly-capillary malformation-polymicrogyria syndrome

  Inheritance: AD Classification: STRONG Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), Genomics England PanelApp
• vascular malformation

  Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
• Cowden disease

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• Cowden syndrome 5

  Inheritance: AD Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae)
• familial ovarian cancer

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
• hereditary breast carcinoma

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen

ACMG classification

Our verdict: Likely_pathogenic. The variant received 8 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 112 pathogenic variants in the truncated region.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
PIK3CA	NM_006218.4	c.29_53delTGTGGGGCATCCACTTGATGCCCCC	p.Leu10GlnfsTer4	frameshift_variant	Exon 2 of 21	ENST00000263967.4	NP_006209.2
PIK3CA	XM_006713658.5	c.29_53delTGTGGGGCATCCACTTGATGCCCCC	p.Leu10GlnfsTer4	frameshift_variant	Exon 2 of 21		XP_006713721.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
PIK3CA	ENST00000263967.4	c.29_53delTGTGGGGCATCCACTTGATGCCCCC	p.Leu10GlnfsTer4	frameshift_variant	Exon 2 of 21	2	NM_006218.4	ENSP00000263967.3

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Cowden syndrome Uncertain:1

May 22, 2018

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant is not present in population databases (ExAC no frequency). This sequence change creates a premature translational stop signal (p.Leu10Glnfs*4) in the PIK3CA gene. It is expected to result in an absent or disrupted protein product. This variant has not been reported in the literature in individuals with PIK3CA-related disease. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. The current clinical and genetic evidence is not sufficient to establish whether loss-of-function variants in PIK3CA cause disease. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.5

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1560137030; hg19: chr3-178916640;