NM_006218.4:c.29_53delTGTGGGGCATCCACTTGATGCCCCC

Variant summary

Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PVS1

The NM_006218.4(PIK3CA):​c.29_53delTGTGGGGCATCCACTTGATGCCCCC​(p.Leu10GlnfsTer4) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. L10L) has been classified as Likely benign.

Frequency

Genomes: not found (cov: 32)

Consequence

PIK3CA
NM_006218.4 frameshift

Scores

Not classified

Clinical Significance

Uncertain significance criteria provided, single submitter U:1

Conservation

PhyloP100: 9.51

Publications

0 publications found
Variant links:
Genes affected
PIK3CA (HGNC:8975): (phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit alpha) Phosphatidylinositol 3-kinase is composed of an 85 kDa regulatory subunit and a 110 kDa catalytic subunit. The protein encoded by this gene represents the catalytic subunit, which uses ATP to phosphorylate PtdIns, PtdIns4P and PtdIns(4,5)P2. This gene has been found to be oncogenic and has been implicated in cervical cancers. A pseudogene of this gene has been defined on chromosome 22. [provided by RefSeq, Apr 2016]
PIK3CA Gene-Disease associations (from GenCC):
  • overgrowth syndrome and/or cerebral malformations due to abnormalities in MTOR pathway genes
    Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
  • megalencephaly-capillary malformation-polymicrogyria syndrome
    Inheritance: AD Classification: STRONG Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), Genomics England PanelApp
  • vascular malformation
    Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
  • Cowden disease
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
  • Cowden syndrome 5
    Inheritance: AD Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae)
  • familial ovarian cancer
    Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
  • hereditary breast carcinoma
    Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Likely_pathogenic. The variant received 8 ACMG points.

PVS1
Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 112 pathogenic variants in the truncated region.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
PIK3CANM_006218.4 linkc.29_53delTGTGGGGCATCCACTTGATGCCCCC p.Leu10GlnfsTer4 frameshift_variant Exon 2 of 21 ENST00000263967.4 NP_006209.2 P42336Q4LE51
PIK3CAXM_006713658.5 linkc.29_53delTGTGGGGCATCCACTTGATGCCCCC p.Leu10GlnfsTer4 frameshift_variant Exon 2 of 21 XP_006713721.1 P42336Q4LE51

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
PIK3CAENST00000263967.4 linkc.29_53delTGTGGGGCATCCACTTGATGCCCCC p.Leu10GlnfsTer4 frameshift_variant Exon 2 of 21 2 NM_006218.4 ENSP00000263967.3 P42336

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Cowden syndrome Uncertain:1
May 22, 2018
Labcorp Genetics (formerly Invitae), Labcorp
Significance:Uncertain significance
Review Status:criteria provided, single submitter
Collection Method:clinical testing

This variant is not present in population databases (ExAC no frequency). This sequence change creates a premature translational stop signal (p.Leu10Glnfs*4) in the PIK3CA gene. It is expected to result in an absent or disrupted protein product. This variant has not been reported in the literature in individuals with PIK3CA-related disease. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. The current clinical and genetic evidence is not sufficient to establish whether loss-of-function variants in PIK3CA cause disease. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
9.5

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs1560137030; hg19: chr3-178916640; API