NM_006231.4:c.3076_3096dupGACTCTGAGCTATTCGAGCTC
Variant summary
Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM4
The NM_006231.4(POLE):c.3076_3096dupGACTCTGAGCTATTCGAGCTC(p.Leu1032_Ile1033insAspSerGluLeuPheGluLeu) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000479 in 1,461,862 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★★). Synonymous variant affecting the same amino acid position (i.e. L1032L) has been classified as Likely benign.
Frequency
Consequence
NM_006231.4 conservative_inframe_insertion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Uncertain_significance. Variant got 2 ACMG points.
Transcripts
RefSeq
Ensembl
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 exome AF: 0.00000479 AC: 7AN: 1461862Hom.: 0 Cov.: 33 AF XY: 0.00000138 AC XY: 1AN XY: 727232
GnomAD4 genome Cov.: 33
ClinVar
Submissions by phenotype
not provided Uncertain:1
This variant, c.3076_3096dup, results in the insertion of 7 amino acid(s) of the POLE protein (p.Asp1026_Leu1032dup), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with POLE-related conditions. ClinVar contains an entry for this variant (Variation ID: 473571). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -
Hereditary cancer-predisposing syndrome Uncertain:1
The c.3076_3096dup21 variant (also known as p.D1026_L1032dup), located in coding exon 26 of the POLE gene, results from an in-frame duplication of 21 nucleotides at nucleotide positions 3076 to 3096. This results in the duplication of 7 extra residues (DSELFEL) between codons 1026 and 1032. This amino acid region is highly conserved in available vertebrate species. In addition, this alteration is predicted to be deleterious by in silico analysis (Choi Y et al. PLoS ONE. 2012; 7(10):e46688). Based on the available evidence, the clinical significance of this variant remains unclear. -
Facial dysmorphism-immunodeficiency-livedo-short stature syndrome;CN280943:Familial colorectal cancer Other:1
Variant interpreted as Uncertain significance and reported on 09-20-2017 by Invitae. GenomeConnect-Invitae Patient Insights Network assertions are reported exactly as they appear on the patient-provided report from the testing laboratory. Registry team members make no attempt to reinterpret the clinical significance of the variant. Phenotypic details are available under supporting information. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at