NM_006506.5:c.3_23dupGGCGGCGGCGGCGCCTGCTGC
Variant summary
Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2PM4
The NM_006506.5(RASA2):c.3_23dupGGCGGCGGCGGCGCCTGCTGC(p.Ala8_Ala9insAlaAlaAlaAlaProAlaAla) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000017 in 1,356,370 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_006506.5 disruptive_inframe_insertion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Uncertain_significance. Variant got 4 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
RASA2 | NM_006506.5 | c.3_23dupGGCGGCGGCGGCGCCTGCTGC | p.Ala8_Ala9insAlaAlaAlaAlaProAlaAla | disruptive_inframe_insertion | Exon 1 of 24 | ENST00000286364.9 | NP_006497.2 | |
RASA2 | NM_001303246.3 | c.3_23dupGGCGGCGGCGGCGCCTGCTGC | p.Ala8_Ala9insAlaAlaAlaAlaProAlaAla | disruptive_inframe_insertion | Exon 1 of 25 | NP_001290175.1 | ||
RASA2 | NM_001303245.3 | c.3_23dupGGCGGCGGCGGCGCCTGCTGC | p.Ala8_Ala9insAlaAlaAlaAlaProAlaAla | disruptive_inframe_insertion | Exon 1 of 24 | NP_001290174.1 | ||
RASA2 | XM_047448652.1 | c.3_23dupGGCGGCGGCGGCGCCTGCTGC | p.Ala8_Ala9insAlaAlaAlaAlaProAlaAla | disruptive_inframe_insertion | Exon 1 of 17 | XP_047304608.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
RASA2 | ENST00000286364.9 | c.3_23dupGGCGGCGGCGGCGCCTGCTGC | p.Ala8_Ala9insAlaAlaAlaAlaProAlaAla | disruptive_inframe_insertion | Exon 1 of 24 | 1 | NM_006506.5 | ENSP00000286364.3 | ||
RASA2 | ENST00000515549.1 | n.3_23dupGGCGGCGGCGGCGCCTGCTGC | non_coding_transcript_exon_variant | Exon 1 of 5 | 4 | ENSP00000424293.1 |
Frequencies
GnomAD3 genomes AF: 0.00000668 AC: 1AN: 149682Hom.: 0 Cov.: 32
GnomAD4 exome AF: 0.0000182 AC: 22AN: 1206688Hom.: 0 Cov.: 30 AF XY: 0.0000186 AC XY: 11AN XY: 591886
GnomAD4 genome AF: 0.00000668 AC: 1AN: 149682Hom.: 0 Cov.: 32 AF XY: 0.00 AC XY: 0AN XY: 73044
ClinVar
Submissions by phenotype
not provided Uncertain:1
This variant, c.3_23dup, results in the insertion of 7 amino acid(s) of the RASA2 protein (p.Ala5_Ala11dup), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with RASA2-related conditions. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at