NM_007146.3:c.1026_1046dupGCAGCAGCAGCAGCAGCAGCA

Variant names:

• chr17-57979243-T-TTGCTGCTGCTGCTGCTGCTGC
• rs57786397
• NM_007146.3:c.1026_1046dupGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Likely benign. Variant got -5 ACMG points: 0P and 5B. BP3 BS2

The NM_007146.3(VEZF1):​c.1026_1046dupGCAGCAGCAGCAGCAGCAGCA​(p.Gln343_Gln349dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000119 in 150,648 control chromosomes in the GnomAD database, with no homozygous occurrence. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.00012 (0 hom., cov: 28)
  • Exomes 𝑓: 0.000031 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: VEZF1 NM_007146.3 disruptive_inframe_insertion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.405

Genes affected

VEZF1 (HGNC:12949): (vascular endothelial zinc finger 1) Transcriptional regulatory proteins containing tandemly repeated zinc finger domains are thought to be involved in both normal and abnormal cellular proliferation and differentiation. ZNF161 is a C2H2-type zinc finger protein (Koyano-Nakagawa et al., 1994 [PubMed 8035792]). See MIM 603971 for general information on zinc finger proteins.[supplied by OMIM, Sep 2008]

ACMG classification

Verdict is Likely_benign. Variant got -5 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_007146.3
• BS2: High AC in GnomAd4 at 18 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
VEZF1	NM_007146.3	c.1026_1046dupGCAGCAGCAGCAGCAGCAGCA	p.Gln343_Gln349dup	disruptive_inframe_insertion	Exon 5 of 6	ENST00000581208.2	NP_009077.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
VEZF1	ENST00000581208.2	c.1026_1046dupGCAGCAGCAGCAGCAGCAGCA	p.Gln343_Gln349dup	disruptive_inframe_insertion	Exon 5 of 6	1	NM_007146.3	ENSP00000462337.1
VEZF1	ENST00000258963.7	c.480_500dupGCAGCAGCAGCAGCAGCAGCA	p.Gln161_Gln167dup	disruptive_inframe_insertion	Exon 4 of 5	1		ENSP00000258963.3
VEZF1	ENST00000584396.5	c.999_1019dupGCAGCAGCAGCAGCAGCAGCA	p.Gln334_Gln340dup	disruptive_inframe_insertion	Exon 5 of 6	5		ENSP00000464687.1

Frequencies

GnomAD3 genomes AF: 0.000119 AC: 18 AN: 150648 Hom.: 0 Cov.: 28

Gnomad AFR AF: 0.000196

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.0000661

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.000387

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000103

Gnomad OTH AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000311 AC: 45 AN: 1446336 Hom.: 0 Cov.: 32 AF XY: 0.0000389 AC XY: 28 AN XY: 719530

Gnomad4 AFR exome AF: 0.0000911

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.0000509

Gnomad4 SAS exome AF: 0.0000236

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.0000245

Gnomad4 OTH exome AF: 0.000184

GnomAD4 genome AF: 0.000119 AC: 18 AN: 150648 Hom.: 0 Cov.: 28 AF XY: 0.0000952 AC XY: 7 AN XY: 73544

Gnomad4 AFR AF: 0.000196

Gnomad4 AMR AF: 0.0000661

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.000387

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.000103

Gnomad4 OTH AF: 0.00

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs57786397; hg19: chr17-56056604;