NM_007194.4:c.91_111dupTCCTCCTCACAGTCCCAGGGC

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2PM4

The NM_007194.4(CHEK2):​c.91_111dupTCCTCCTCACAGTCCCAGGGC​(p.Gly37_Ile38insSerSerSerGlnSerGlnGly) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★★).

Frequency

Genomes: not found (cov: 31)

Consequence

CHEK2
NM_007194.4 conservative_inframe_insertion

Scores

Not classified

Clinical Significance

Uncertain significance criteria provided, multiple submitters, no conflicts U:2

Conservation

PhyloP100: -0.0320
Variant links:
Genes affected
CHEK2 (HGNC:16627): (checkpoint kinase 2) In response to DNA damage and replication blocks, cell cycle progression is halted through the control of critical cell cycle regulators. The protein encoded by this gene is a cell cycle checkpoint regulator and putative tumor suppressor. It contains a forkhead-associated protein interaction domain essential for activation in response to DNA damage and is rapidly phosphorylated in response to replication blocks and DNA damage. When activated, the encoded protein is known to inhibit CDC25C phosphatase, preventing entry into mitosis, and has been shown to stabilize the tumor suppressor protein p53, leading to cell cycle arrest in G1. In addition, this protein interacts with and phosphorylates BRCA1, allowing BRCA1 to restore survival after DNA damage. Mutations in this gene have been linked with Li-Fraumeni syndrome, a highly penetrant familial cancer phenotype usually associated with inherited mutations in TP53. Also, mutations in this gene are thought to confer a predisposition to sarcomas, breast cancer, and brain tumors. This nuclear protein is a member of the CDS1 subfamily of serine/threonine protein kinases. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Uncertain_significance. Variant got 4 ACMG points.

PM2
Very rare variant in population databases, with high coverage;
PM4
Nonframeshift variant in NON repetitive region in NM_007194.4.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
CHEK2NM_007194.4 linkc.91_111dupTCCTCCTCACAGTCCCAGGGC p.Gly37_Ile38insSerSerSerGlnSerGlnGly conservative_inframe_insertion Exon 2 of 15 ENST00000404276.6 NP_009125.1 O96017-1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
CHEK2ENST00000404276.6 linkc.91_111dupTCCTCCTCACAGTCCCAGGGC p.Gly37_Ile38insSerSerSerGlnSerGlnGly conservative_inframe_insertion Exon 2 of 15 1 NM_007194.4 ENSP00000385747.1 O96017-1

Frequencies

GnomAD3 genomes
Cov.:
31
GnomAD4 exome
Cov.:
33
GnomAD4 genome
Cov.:
31

ClinVar

Significance: Uncertain significance
Submissions summary: Uncertain:2
Revision: criteria provided, multiple submitters, no conflicts
LINK: link

Submissions by phenotype

Familial cancer of breast Uncertain:1
Jan 03, 2022
Labcorp Genetics (formerly Invitae), Labcorp
Significance: Uncertain significance
Review Status: criteria provided, single submitter
Collection Method: clinical testing

This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with CHEK2-related conditions. ClinVar contains an entry for this variant (Variation ID: 229673). Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may create or strengthen a splice site. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. This variant, c.91_111dup, results in the insertion of 7 amino acid(s) of the CHEK2 protein (p.Ser31_Gly37dup), but otherwise preserves the integrity of the reading frame. -

Hereditary cancer-predisposing syndrome Uncertain:1
Jan 05, 2015
Ambry Genetics
Significance: Uncertain significance
Review Status: criteria provided, single submitter
Collection Method: clinical testing

The c.91_111dup21 variant (also known as p.S31_G37DUP) located in coding exon 1 of the CHEK2 gene, results from an in-frame 21 nucleotide duplication between nucleotide positions 91 and 111. This results in the duplication of codons 31 to 37, located in the SQ/TQ cluster domain (Matsuoka S, et al. Proc. Natl. Acad. Sci. U.S.A. 2000 Sep; 97(19):10389-94). This variant was not reported in population based cohorts in the following databases: Database of Single Nucleotide Polymorphisms (dbSNP), NHLBI Exome Sequencing Project (ESP), and 1000 Genomes Project. In the ESP, this variant was not observed in 6503 samples (13006 alleles) with coverage at this position. To date, this alteration has been detected with an allele frequency of approximately 0.004% (greater than 26000 alleles tested) in our clinical cohort. These amino acid positions are well conserved in available vertebrate species. Since supporting evidence is limited at this time, the clinical significance of c.91_111dup21 remains unclear. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs876658135; hg19: chr22-29130598; API