NM_007294.4:c.19_47delCGCGTTGAAGAAGTACAAAATGTCATTAA

Variant summary

Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1PM2PP5_Very_Strong

The NM_007294.4(BRCA1):​c.19_47delCGCGTTGAAGAAGTACAAAATGTCATTAA​(p.Arg7CysfsTer24) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★★★). Synonymous variant affecting the same amino acid position (i.e. R7R) has been classified as Likely benign.

Frequency

Genomes: not found (cov: 32)

Consequence

BRCA1
NM_007294.4 frameshift

Scores

Not classified

Clinical Significance

Pathogenic reviewed by expert panel P:7

Conservation

PhyloP100: 4.17
Variant links:
Genes affected
BRCA1 (HGNC:1100): (BRCA1 DNA repair associated) This gene encodes a 190 kD nuclear phosphoprotein that plays a role in maintaining genomic stability, and it also acts as a tumor suppressor. The BRCA1 gene contains 22 exons spanning about 110 kb of DNA. The encoded protein combines with other tumor suppressors, DNA damage sensors, and signal transducers to form a large multi-subunit protein complex known as the BRCA1-associated genome surveillance complex (BASC). This gene product associates with RNA polymerase II, and through the C-terminal domain, also interacts with histone deacetylase complexes. This protein thus plays a role in transcription, DNA repair of double-stranded breaks, and recombination. Mutations in this gene are responsible for approximately 40% of inherited breast cancers and more than 80% of inherited breast and ovarian cancers. Alternative splicing plays a role in modulating the subcellular localization and physiological function of this gene. Many alternatively spliced transcript variants, some of which are disease-associated mutations, have been described for this gene, but the full-length natures of only some of these variants has been described. A related pseudogene, which is also located on chromosome 17, has been identified. [provided by RefSeq, May 2020]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Pathogenic. Variant got 18 ACMG points.

PVS1
Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 1703 pathogenic variants in the truncated region.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 17-43124049-ATTAATGACATTTTGTACTTCTTCAACGCG-A is Pathogenic according to our data. Variant chr17-43124049-ATTAATGACATTTTGTACTTCTTCAACGCG-A is described in ClinVar as [Pathogenic]. Clinvar id is 125491.Status of the report is reviewed_by_expert_panel, 3 stars. Variant chr17-43124049-ATTAATGACATTTTGTACTTCTTCAACGCG-A is described in Lovd as [Pathogenic]. Variant chr17-43124049-ATTAATGACATTTTGTACTTCTTCAACGCG-A is described in Lovd as [Pathogenic].

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
BRCA1NM_007294.4 linkc.19_47delCGCGTTGAAGAAGTACAAAATGTCATTAA p.Arg7CysfsTer24 frameshift_variant Exon 2 of 23 ENST00000357654.9 NP_009225.1 P38398-1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
BRCA1ENST00000357654.9 linkc.19_47delCGCGTTGAAGAAGTACAAAATGTCATTAA p.Arg7CysfsTer24 frameshift_variant Exon 2 of 23 1 NM_007294.4 ENSP00000350283.3 P38398-1

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:7
Revision: reviewed by expert panel
LINK: link

Submissions by phenotype

Breast-ovarian cancer, familial, susceptibility to, 1 Pathogenic:4
-
Biomedical Genomics and Oncogenetics Laboratory, Institut Pasteur de Tunis, University Tunis El Manar
Significance: Pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

- -

Jun 23, 1999
Breast Cancer Information Core (BIC) (BRCA1)
Significance: Pathogenic
Review Status: no assertion criteria provided
Collection Method: clinical testing

- -

Sep 08, 2016
Evidence-based Network for the Interpretation of Germline Mutant Alleles (ENIGMA)
Significance: Pathogenic
Review Status: reviewed by expert panel
Collection Method: curation

Variant allele predicted to encode a truncated non-functional protein. -

Oct 02, 2015
Consortium of Investigators of Modifiers of BRCA1/2 (CIMBA), c/o University of Cambridge
Significance: Pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

- -

not provided Pathogenic:1
May 16, 2023
Quest Diagnostics Nichols Institute San Juan Capistrano
Significance: Pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

The BRCA1 c.19_47del (p.Arg7Cysfs*24) variant alters the translational reading frame of the BRCA1 mRNA and causes the premature termination of BRCA1 protein synthesis. This variant has been reported in the published literature in affected individuals/families with a personal and/or family history of breast and/or ovarian cancer (PMIDs: 21120943 (2011), 22762150 (2012), 32341426 (2020), and 34490083 (2021)). This variant has not been reported in large, multi-ethnic general populations (Genome Aggregation Database, http://gnomad.broadinstitute.org). Based on the available information, this variant is classified as pathogenic. -

Hereditary cancer-predisposing syndrome Pathogenic:1
Sep 03, 2021
Ambry Genetics
Significance: Pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

The c.19_47del29 pathogenic mutation, located in coding exon 1 of the BRCA1 gene, results from a deletion of 29 nucleotides at nucleotide positions 19 to 47, causing a translational frameshift with a predicted alternate stop codon (p.R7Cfs*24). In one study, this variant was observed in 1/1525 unrelated patients who had BRCA1/2 genetic testing due to a personal and/or family history suspicious for Hereditary Breast and/or Ovarian Cancer syndrome. (Caux-Moncoutier V et al. Hum Mutat, 2011 Mar;32:325-34). In addition to the clinical data presented in the literature, this alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation. -

Hereditary breast ovarian cancer syndrome Pathogenic:1
Sep 25, 2024
Labcorp Genetics (formerly Invitae), Labcorp
Significance: Pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

This sequence change creates a premature translational stop signal (p.Arg7Cysfs*24) in the BRCA1 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in BRCA1 are known to be pathogenic (PMID: 20104584). This variant is not present in population databases (gnomAD no frequency). This premature translational stop signal has been observed in individual(s) with personal or family history of breast and/or ovarian cancer (PMID: 21120943, 22762150, 27656653). ClinVar contains an entry for this variant (Variation ID: 125491). For these reasons, this variant has been classified as Pathogenic. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs80359871; hg19: chr17-41276066; API