NM_013275.6:c.6112_6132delAAGGACGGAGTGGACGCCGTC
Variant summary
Our verdict is Likely benign. The variant received -2 ACMG points: 2P and 4B. PM4BS2
The NM_013275.6(ANKRD11):c.6112_6132delAAGGACGGAGTGGACGCCGTC(p.Lys2038_Val2044del) variant causes a conservative inframe deletion change. The variant allele was found at a frequency of 0.0000115 in 1,563,018 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★).
Frequency
Consequence
NM_013275.6 conservative_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- KBG syndromeInheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet, Ambry Genetics, G2P, Illumina, ClinGen
- congenital heart defects, multiple typesInheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -2 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt | 
|---|---|---|---|---|---|---|---|---|
| ANKRD11 | NM_013275.6 | c.6112_6132delAAGGACGGAGTGGACGCCGTC | p.Lys2038_Val2044del | conservative_inframe_deletion | Exon 9 of 13 | ENST00000301030.10 | NP_037407.4 | |
| ANKRD11 | NM_001256182.2 | c.6112_6132delAAGGACGGAGTGGACGCCGTC | p.Lys2038_Val2044del | conservative_inframe_deletion | Exon 10 of 14 | NP_001243111.1 | ||
| ANKRD11 | NM_001256183.2 | c.6112_6132delAAGGACGGAGTGGACGCCGTC | p.Lys2038_Val2044del | conservative_inframe_deletion | Exon 9 of 13 | NP_001243112.1 | 
Ensembl
Frequencies
GnomAD3 genomes  0.0000131  AC: 2AN: 152216Hom.:  0  Cov.: 32 show subpopulations 
GnomAD2 exomes  AF:  0.00000516  AC: 1AN: 193700 AF XY:  0.00000935   show subpopulations 
GnomAD4 exome  AF:  0.0000113  AC: 16AN: 1410802Hom.:  0   AF XY:  0.0000129  AC XY: 9AN XY: 696320 show subpopulations 
Age Distribution
GnomAD4 genome  0.0000131  AC: 2AN: 152216Hom.:  0  Cov.: 32 AF XY:  0.0000134  AC XY: 1AN XY: 74384 show subpopulations 
Age Distribution
ClinVar
Submissions by phenotype
KBG syndrome    Uncertain:2 
In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. ClinVar contains an entry for this variant (Variation ID: 547991). This variant has not been reported in the literature in individuals affected with ANKRD11-related conditions. This variant is present in population databases (rs748553966, gnomAD 0.006%). This variant, c.6112_6132del, results in the deletion of 7 amino acid(s) of the ANKRD11 protein (p.Lys2038_Val2044del), but otherwise preserves the integrity of the reading frame. -
- -
Computational scores
Source: 
Splicing
 Find out detailed SpliceAI scores and Pangolin per-transcript scores at