NM_014049.5:c.5_30dupGCGGCTGCGGGCTCTTCCTGCGCACC

Variant names:

• chr3-128879695-A-AGCGGCTGCGGGCTCTTCCTGCGCACC
• NM_014049.5:c.5_30dupGCGGCTGCGGGCTCTTCCTGCGCACC

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_014049.5(ACAD9):​c.5_30dupGCGGCTGCGGGCTCTTCCTGCGCACC​(p.Thr11AlafsTer44) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. T11T) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 33)
• Consequence: ACAD9 NM_014049.5 frameshift
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: -0.781
• Publications: 0 publications found

Genes affected

ACAD9 (HGNC:21497): (acyl-CoA dehydrogenase family member 9) This gene encodes a member of the acyl-CoA dehydrogenase family. Members of this family of proteins localize to the mitochondria and catalyze the rate-limiting step in the beta-oxidation of fatty acyl-CoA. The encoded protein is specifically active toward palmitoyl-CoA and long-chain unsaturated substrates. Mutations in this gene cause acyl-CoA dehydrogenase family member type 9 deficiency. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Mar 2010]

ACAD9-DT (HGNC:56086): (ACAD9 divergent transcript)

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 140 pathogenic variants in the truncated region.
• PP5: Variant 3-128879695-A-AGCGGCTGCGGGCTCTTCCTGCGCACC is Pathogenic according to our data. Variant chr3-128879695-A-AGCGGCTGCGGGCTCTTCCTGCGCACC is described in ClinVar as Likely_pathogenic. ClinVar VariationId is 2679733.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_014049.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ACAD9	NM_014049.5	MANE Select	c.5_30dupGCGGCTGCGGGCTCTTCCTGCGCACC	p.Thr11AlafsTer44	frameshift	Exon 1 of 18	NP_054768.2
	ACAD9	NM_001410805.1		c.-271_-246dupGCGGCTGCGGGCTCTTCCTGCGCACC		5_prime_UTR	Exon 1 of 17	NP_001397734.1	Q9H9W4
	ACAD9	NR_033426.2		n.77_102dupGCGGCTGCGGGCTCTTCCTGCGCACC		non_coding_transcript_exon	Exon 1 of 18

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ACAD9	ENST00000308982.12	TSL:1 MANE Select	c.5_30dupGCGGCTGCGGGCTCTTCCTGCGCACC	p.Thr11AlafsTer44	frameshift	Exon 1 of 18	ENSP00000312618.7	Q9H845
	ACAD9	ENST00000681367.1		c.5_30dupGCGGCTGCGGGCTCTTCCTGCGCACC	p.Thr11AlafsTer44	frameshift	Exon 1 of 19	ENSP00000505309.1	A0A7P0T8U3
	ACAD9	ENST00000680636.1		c.5_30dupGCGGCTGCGGGCTCTTCCTGCGCACC	p.Thr11AlafsTer44	frameshift	Exon 1 of 18	ENSP00000504886.1	A0A7P0T7Z1

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome Cov.: 31

GnomAD4 genome Cov.: 33

ClinVar

ClinVar submissions

Significance: Likely pathogenic

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
1	-	-	Acyl-CoA dehydrogenase 9 deficiency (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		-0.78

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

hg19: chr3-128598538;