NM_014629.4:c.38-60_38-33delATCTATCTATCTATCTATCTATCTATCT

Variant names:

• chr8-1857879-GATCTATCTATCTATCTATCTATCTATCT-G
• rs35698984
• NM_014629.4:c.38-60_38-33delATCTATCTATCTATCTATCTATCTATCT

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The NM_014629.4(ARHGEF10):​c.38-60_38-33delATCTATCTATCTATCTATCTATCTATCT variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000416 in 480,668 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: not found (cov: 24)
  • Exomes 𝑓: 0.0000042 (0 hom.)
• Consequence: ARHGEF10 NM_014629.4 intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 1.10
• Publications: 0 publications found

Genes affected

ARHGEF10 (HGNC:14103): (Rho guanine nucleotide exchange factor 10) This gene encodes a Rho guanine nucleotide exchange factor (GEF). Rho GEFs regulate the activity of small Rho GTPases by stimulating the exchange of guanine diphosphate (GDP) for guanine triphosphate (GTP) and may play a role in neural morphogenesis. Mutations in this gene are associated with slowed nerve conduction velocity (SNCV). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]

ARHGEF10 Gene-Disease associations (from GenCC):

• autosomal dominant slowed nerve conduction velocity

  Inheritance: Unknown, AD Classification: SUPPORTIVE, LIMITED Submitted by: Labcorp Genetics (formerly Invitae), ClinGen, Orphanet
• hereditary peripheral neuropathy

  Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
• peripheral neuropathy

  Inheritance: AD Classification: LIMITED Submitted by: Ambry Genetics

KBTBD11-OT1 (HGNC:):

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_014629.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ARHGEF10	NM_014629.4	MANE Select	c.38-60_38-33delATCTATCTATCTATCTATCTATCTATCT		intron	N/A	NP_055444.2	O15013-5
	ARHGEF10	NM_001438091.1		c.38-60_38-33delATCTATCTATCTATCTATCTATCTATCT		intron	N/A	NP_001425020.1
	ARHGEF10	NM_001308153.3		c.38-60_38-33delATCTATCTATCTATCTATCTATCTATCT		intron	N/A	NP_001295082.2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ARHGEF10	ENST00000349830.8	TSL:1 MANE Select	c.38-80_38-53delATCTATCTATCTATCTATCTATCTATCT		intron	N/A	ENSP00000340297.3	O15013-5
	ARHGEF10	ENST00000518288.5	TSL:1	c.110-80_110-53delATCTATCTATCTATCTATCTATCTATCT		intron	N/A	ENSP00000431012.1	O15013-6
	ARHGEF10	ENST00000520359.5	TSL:1	c.38-80_38-53delATCTATCTATCTATCTATCTATCTATCT		intron	N/A	ENSP00000427909.1	O15013-7

Frequencies

GnomAD3 genomes Cov.: 24

GnomAD4 exome AF: 0.00000416 AC: 2 AN: 480668 Hom.: 0 AF XY: 0.00000392 AC XY: 1 AN XY: 255064

African (AFR) AF: 0.00 AC: 0 AN: 11426

American (AMR) AF: 0.00 AC: 0 AN: 22832

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 13808

East Asian (EAS) AF: 0.0000362 AC: 1 AN: 27590

South Asian (SAS) AF: 0.00 AC: 0 AN: 45536

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 34240

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 2300

European-Non Finnish (NFE) AF: 0.00000336 AC: 1 AN: 297948

Other (OTH) AF: 0.00 AC: 0 AN: 24988

GnomAD4 genome Cov.: 24

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.1

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs35698984; hg19: chr8-1806045;