NM_016580.4:c.3490_3509delCCAGGTGGAAAGACGGGGAC

Variant summary

Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PVS1_ModeratePM2

The NM_016580.4(PCDH12):​c.3490_3509delCCAGGTGGAAAGACGGGGAC​(p.Pro1164fs) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

Frequency

Genomes: not found (cov: 33)

Consequence

PCDH12
NM_016580.4 frameshift

Scores

Not classified

Clinical Significance

Uncertain significance criteria provided, single submitter U:1

Conservation

PhyloP100: 1.52
Variant links:
Genes affected
PCDH12 (HGNC:8657): (protocadherin 12) This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. The encoded protein consists of an extracellular domain containing 6 cadherin repeats, a transmembrane domain and a cytoplasmic tail that differs from those of the classical cadherins. The gene localizes to the region on chromosome 5 where the protocadherin gene clusters reside. The exon organization of this transcript is similar to that of the gene cluster transcripts, notably the first large exon, but no significant sequence homology exists. The function of this cellular adhesion protein is undetermined but mouse protocadherin 12 does not bind catenins and appears to have no affect on cell migration or growth. [provided by RefSeq, Jul 2008]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Uncertain_significance. Variant got 4 ACMG points.

PVS1
Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. Fraction of 0.0183 CDS is truncated, and there are 0 pathogenic variants in the truncated region.
PM2
Very rare variant in population databases, with high coverage;

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
PCDH12NM_016580.4 linkc.3490_3509delCCAGGTGGAAAGACGGGGAC p.Pro1164fs frameshift_variant Exon 4 of 4 ENST00000231484.4 NP_057664.1 Q9NPG4

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
PCDH12ENST00000231484.4 linkc.3490_3509delCCAGGTGGAAAGACGGGGAC p.Pro1164fs frameshift_variant Exon 4 of 4 1 NM_016580.4 ENSP00000231484.3 Q9NPG4

Frequencies

GnomAD3 genomes
Cov.:
33
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
33

ClinVar

Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

not provided Uncertain:1
Dec 13, 2024
Labcorp Genetics (formerly Invitae), Labcorp
Significance: Uncertain significance
Review Status: criteria provided, single submitter
Collection Method: clinical testing

This sequence change creates a premature translational stop signal (p.Pro1164*) in the PCDH12 gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 21 amino acid(s) of the PCDH12 protein. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with PCDH12-related conditions. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr5-141324991; API