NM_020655.4:c.382+772_382+801dupCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG

Variant names:

• chr16-87604287-C-CCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG
• rs71156237
• NM_020655.4:c.382+772_382+801dupCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG

Variant summary

Our verdict is Likely benign. The variant received -4 ACMG points: 0P and 4B. BS2

The NM_020655.4(JPH3):​c.382+772_382+801dupCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG variant causes a intron change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.00059 (1 hom., cov: 0)
  • Exomes 𝑓: 0.00018 (7 hom.)
  • Failed GnomAD Quality Control
• Consequence: JPH3 NM_020655.4 intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.966
• Publications: 1 publications found

Genes affected

JPH3 (HGNC:14203): (junctophilin 3) Junctional complexes between the plasma membrane and endoplasmic/sarcoplasmic reticulum are a common feature of all excitable cell types and mediate cross talk between cell surface and intracellular ion channels. The protein encoded by this gene is a component of junctional complexes and is composed of a C-terminal hydrophobic segment spanning the endoplasmic/sarcoplasmic reticulum membrane and a remaining cytoplasmic domain that shows specific affinity for the plasma membrane. CAG/CTG repeat expansion from normally 6-28 repeats to 40-59 repeats in the 3' UTR of this gene have been associated with Huntington disease-like 2 (HDL2). This gene is a member of the junctophilin gene family. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Jul 2016]

JPH3 Gene-Disease associations (from GenCC):

• Huntington disease-like 2

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, Orphanet

ACMG classification

Our verdict: Likely_benign. The variant received -4 ACMG points.

• BS2: High AC in GnomAd4 at 88 AD gene.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_020655.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	JPH3	NM_020655.4	MANE Select	c.382+772_382+801dupCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG		intron	N/A	NP_065706.2
	JPH3	NM_001271604.4		c.443_472dupCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG	p.Ala148_Ala157dup	disruptive_inframe_insertion	Exon 2 of 2	NP_001258533.1	F8W9A3
	JPH3	NM_001271605.3		c.*141_*170dupCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG		3_prime_UTR	Exon 2 of 2	NP_001258534.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	JPH3	ENST00000284262.3	TSL:1 MANE Select	c.382+772_382+801dupCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG		intron	N/A	ENSP00000284262.2	Q8WXH2-1
	JPH3	ENST00000301008.5	TSL:1	n.703_732dupCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG		non_coding_transcript_exon	Exon 2 of 2
	JPH3	ENST00000537256.5	TSL:2	n.96+2370_96+2399dupCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG		intron	N/A

Frequencies

GnomAD3 genomes AF: 0.000580 AC: 87 AN: 149958 Hom.: 1 Cov.: 0

Gnomad AFR AF: 0.000764

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000595

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.000424

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.0223

Gnomad NFE AF: 0.000534

Gnomad OTH AF: 0.000974

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.000179 AC: 229 AN: 1282836 Hom.: 7 Cov.: 30 AF XY: 0.000166 AC XY: 105 AN XY: 633000

African (AFR) AF: 0.000600 AC: 17 AN: 28324

American (AMR) AF: 0.000741 AC: 24 AN: 32396

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 21658

East Asian (EAS) AF: 0.000125 AC: 3 AN: 24078

South Asian (SAS) AF: 0.000103 AC: 8 AN: 77828

European-Finnish (FIN) AF: 0.000102 AC: 3 AN: 29388

Middle Eastern (MID) AF: 0.00336 AC: 17 AN: 5062

European-Non Finnish (NFE) AF: 0.000133 AC: 135 AN: 1013032

Other (OTH) AF: 0.000431 AC: 22 AN: 51070

GnomAD4 genome AF: 0.000586 AC: 88 AN: 150066 Hom.: 1 Cov.: 0 AF XY: 0.000601 AC XY: 44 AN XY: 73222

African (AFR) AF: 0.000787 AC: 32 AN: 40668

American (AMR) AF: 0.000594 AC: 9 AN: 15150

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3448

East Asian (EAS) AF: 0.00 AC: 0 AN: 5062

South Asian (SAS) AF: 0.000425 AC: 2 AN: 4710

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10302

Middle Eastern (MID) AF: 0.0240 AC: 7 AN: 292

European-Non Finnish (NFE) AF: 0.000534 AC: 36 AN: 67458

Other (OTH) AF: 0.000963 AC: 2 AN: 2076

Alfa AF: 0.00 Hom.: 316

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.97
Mutation Taster		=100/0	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs71156237; hg19: chr16-87637893;