NM_021008.4:c.247_267delCTGCCCGGCCCCGACGAGGCC

Variant names:

• chr11-694780-CGGCCTCGTCGGGGCCGGGCAG-C
• rs1861033651
• NM_021008.4:c.247_267delCTGCCCGGCCCCGACGAGGCC

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_021008.4(DEAF1):​c.247_267delCTGCCCGGCCCCGACGAGGCC​(p.Leu83_Ala89del) variant causes a conservative inframe deletion change. The variant allele was found at a frequency of 0.00000169 in 1,181,800 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: not found (cov: 32)
  • Exomes 𝑓: 0.0000017 (0 hom.)
• Consequence: DEAF1 NM_021008.4 conservative_inframe_deletion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 6.59
• Publications: 0 publications found

Genes affected

DEAF1 (HGNC:14677): (DEAF1 transcription factor) This gene encodes a zinc finger domain-containing protein that functions as a regulator of transcription. The encoded proteins binds to its own promoter as well as to that of several target genes. Activity of this protein is important in the regulation of embryonic development. Mutations in this gene have been found in individuals with autosomal dominant cognitive disability. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]

EPS8L2 (HGNC:21296): (EPS8 signaling adaptor L2) This gene encodes a member of the EPS8 gene family. The encoded protein, like other members of the family, is thought to link growth factor stimulation to actin organization, generating functional redundancy in the pathways that regulate actin cytoskeletal remodeling. [provided by RefSeq, Dec 2008]

EPS8L2 Gene-Disease associations (from GenCC):

• hearing loss, autosomal recessive 106

  Inheritance: AR Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
• nonsyndromic genetic hearing loss

  Inheritance: AR Classification: MODERATE Submitted by: ClinGen
• hearing loss, autosomal recessive

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_021008.4.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_021008.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	DEAF1	NM_021008.4	MANE Select	c.247_267delCTGCCCGGCCCCGACGAGGCC	p.Leu83_Ala89del	conservative_inframe_deletion	Exon 1 of 12	NP_066288.2
	DEAF1	NM_001440883.1		c.247_267delCTGCCCGGCCCCGACGAGGCC	p.Leu83_Ala89del	conservative_inframe_deletion	Exon 1 of 11	NP_001427812.1
	DEAF1	NM_001440884.1		c.247_267delCTGCCCGGCCCCGACGAGGCC	p.Leu83_Ala89del	conservative_inframe_deletion	Exon 1 of 11	NP_001427813.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	DEAF1	ENST00000382409.4	TSL:1 MANE Select	c.247_267delCTGCCCGGCCCCGACGAGGCC	p.Leu83_Ala89del	conservative_inframe_deletion	Exon 1 of 12	ENSP00000371846.3	O75398-1
	DEAF1	ENST00000882097.1		c.247_267delCTGCCCGGCCCCGACGAGGCC	p.Leu83_Ala89del	conservative_inframe_deletion	Exon 1 of 13	ENSP00000552156.1
	DEAF1	ENST00000685854.1		c.43_63delCTGCCCGGCCCCGACGAGGCC	p.Leu15_Ala21del	conservative_inframe_deletion	Exon 1 of 14	ENSP00000508801.1	A0A8I5KQY1

Frequencies

GnomAD3 genomes Cov.: 32

GnomAD4 exome AF: 0.00000169 AC: 2 AN: 1181800 Hom.: 0 AF XY: 0.00000175 AC XY: 1 AN XY: 572824

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 23412

American (AMR) AF: 0.00 AC: 0 AN: 9870

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 16204

East Asian (EAS) AF: 0.00 AC: 0 AN: 26520

South Asian (SAS) AF: 0.00 AC: 0 AN: 46044

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 27760

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 3310

European-Non Finnish (NFE) AF: 0.00000204 AC: 2 AN: 980430

Other (OTH) AF: 0.00 AC: 0 AN: 48250

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.000203476), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome Cov.: 32

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		6.6

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1861033651; hg19: chr11-694780;