NM_021147.5:c.875_897delACCGCATGCTGCGGGTCTCGCGG
Variant summary
Our verdict is Likely pathogenic. The variant received 6 ACMG points: 6P and 0B. PVS1_StrongPP5_Moderate
The NM_021147.5(CCNO):c.875_897delACCGCATGCTGCGGGTCTCGCGG(p.Asp292AlafsTer71) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000031 in 1,613,554 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★).
Frequency
Consequence
NM_021147.5 frameshift
Scores
Clinical Significance
Conservation
Publications
- primary ciliary dyskinesia 29Inheritance: AR Classification: DEFINITIVE, STRONG, MODERATE Submitted by: G2P, Labcorp Genetics (formerly Invitae), PanelApp Australia, ClinGen, Ambry Genetics
- primary ciliary dyskinesiaInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Likely_pathogenic. The variant received 6 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
CCNO | NM_021147.5 | c.875_897delACCGCATGCTGCGGGTCTCGCGG | p.Asp292AlafsTer71 | frameshift_variant | Exon 3 of 3 | ENST00000282572.5 | NP_066970.3 | |
CCNO | NR_125346.2 | n.1336_1358delACCGCATGCTGCGGGTCTCGCGG | non_coding_transcript_exon_variant | Exon 3 of 3 | ||||
CCNO | NR_125347.2 | n.965_987delACCGCATGCTGCGGGTCTCGCGG | non_coding_transcript_exon_variant | Exon 3 of 3 | ||||
CCNO | NR_125348.1 | n.939_961delACCGCATGCTGCGGGTCTCGCGG | non_coding_transcript_exon_variant | Exon 2 of 2 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
CCNO | ENST00000282572.5 | c.875_897delACCGCATGCTGCGGGTCTCGCGG | p.Asp292AlafsTer71 | frameshift_variant | Exon 3 of 3 | 1 | NM_021147.5 | ENSP00000282572.4 | ||
CCNO | ENST00000501463.2 | n.*855_*877delACCGCATGCTGCGGGTCTCGCGG | non_coding_transcript_exon_variant | Exon 3 of 3 | 1 | ENSP00000422485.1 | ||||
CCNO | ENST00000501463.2 | n.*855_*877delACCGCATGCTGCGGGTCTCGCGG | 3_prime_UTR_variant | Exon 3 of 3 | 1 | ENSP00000422485.1 |
Frequencies
GnomAD3 genomes AF: 0.0000131 AC: 2AN: 152236Hom.: 0 Cov.: 33 show subpopulations
GnomAD2 exomes AF: 0.00000399 AC: 1AN: 250548 AF XY: 0.00000737 show subpopulations
GnomAD4 exome AF: 0.00000205 AC: 3AN: 1461318Hom.: 0 AF XY: 0.00000138 AC XY: 1AN XY: 727014 show subpopulations
GnomAD4 genome AF: 0.0000131 AC: 2AN: 152236Hom.: 0 Cov.: 33 AF XY: 0.0000269 AC XY: 2AN XY: 74366 show subpopulations ⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5.
ClinVar
Submissions by phenotype
Primary ciliary dyskinesia Pathogenic:1
This sequence change creates a premature translational stop signal (p.Asp292Alafs*71) in the CCNO gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 59 amino acid(s) of the CCNO protein. This variant is present in population databases (no rsID available, gnomAD no frequency). This variant has not been reported in the literature in individuals affected with CCNO-related conditions. ClinVar contains an entry for this variant (Variation ID: 861050). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. This variant disrupts a region of the CCNO protein in which other variant(s) (p.Gln321*) have been determined to be pathogenic (PMID: 24747639, 26139845). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. For these reasons, this variant has been classified as Pathogenic. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at