NM_021973.3:c.269_320delCGGGCCTGGGGGGGCCGCGCCCGGTGAAGCGCCGAGGCACCGCCAACCGCAA

Variant names:

• chr4-173528969-CTTGCGGTTGGCGGTGCCTCGGCGCTTCACCGGGCGCGGCCCCCCCAGGCCCG-C
• NM_021973.3:c.269_320delCGGGCCTGGGGGGGCCGCGCCCGGTGAAGCGCCGAGGCACCGCCAACCGCAA

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The NM_021973.3(HAND2):​c.269_320delCGGGCCTGGGGGGGCCGCGCCCGGTGAAGCGCCGAGGCACCGCCAACCGCAA​(p.Pro90ArgfsTer70) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: HAND2 NM_021973.3 frameshift
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 6.32
• Publications: 0 publications found

Genes affected

HAND2 (HGNC:4808): (heart and neural crest derivatives expressed 2) The protein encoded by this gene belongs to the basic helix-loop-helix family of transcription factors. This gene product is one of two closely related family members, the HAND proteins, which are asymmetrically expressed in the developing ventricular chambers and play an essential role in cardiac morphogenesis. Working in a complementary fashion, they function in the formation of the right ventricle and aortic arch arteries, implicating them as mediators of congenital heart disease. In addition, this transcription factor plays an important role in limb and branchial arch development. [provided by RefSeq, Jul 2008]

HAND2-AS1 (HGNC:48872): (HAND2 antisense RNA 1) Predicted to be involved in positive regulation of gene expression. Predicted to act upstream of or within with a positive effect on cardiac right ventricle morphogenesis. Predicted to act upstream of or within transcription elongation from RNA polymerase II promoter. Predicted to be located in chromatin; cytoplasm; and nucleoplasm. [provided by Alliance of Genome Resources, Apr 2022]

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_021973.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	HAND2	NM_021973.3	MANE Select	c.269_320delCGGGCCTGGGGGGGCCGCGCCCGGTGAAGCGCCGAGGCACCGCCAACCGCAA	p.Pro90ArgfsTer70	frameshift	Exon 1 of 2	NP_068808.1	P61296-1
	HAND2-AS1	NR_136197.1		n.240+131_240+182delTTGCGGTTGGCGGTGCCTCGGCGCTTCACCGGGCGCGGCCCCCCCAGGCCCG		intron	N/A

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	HAND2	ENST00000359562.4	TSL:1 MANE Select	c.269_320delCGGGCCTGGGGGGGCCGCGCCCGGTGAAGCGCCGAGGCACCGCCAACCGCAA	p.Pro90ArgfsTer70	frameshift	Exon 1 of 2	ENSP00000352565.4	P61296-1
	HAND2	ENST00000505300.1	TSL:5	n.431_482delCGGGCCTGGGGGGGCCGCGCCCGGTGAAGCGCCGAGGCACCGCCAACCGCAA		non_coding_transcript_exon	Exon 3 of 3
	HAND2-AS1	ENST00000512099.5	TSL:2	n.1232+469_1232+520delTTGCGGTTGGCGGTGCCTCGGCGCTTCACCGGGCGCGGCCCCCCCAGGCCCG		intron	N/A

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Uncertain significance

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	1	-	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		6.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

hg19: chr4-174450120;