Variant NM_021973.3:c.269_320delCGGGCCTGGGGGGGCCGCGCCCGGTGAAGCGCCGAGGCACCGCCAACCGCAA details in Genebe, Genetics Data Aggregator

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM2

The NM_021973.3(HAND2):c.269_320delCGGGCCTGGGGGGGCCGCGCCCGGTGAAGCGCCGAGGCACCGCCAACCGCAA(p.Pro90ArgfsTer70) variant causes a frameshift change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

Frequency

Genomes: not found (cov: 32)

Consequence

HAND2
NM_021973.3 frameshift

Scores

Not classified

Clinical Significance

Uncertain significance criteria provided, single submitter U:1

Conservation

PhyloP100: 6.32

Variant links:

Genes affected

HAND2 (HGNC:4808): (heart and neural crest derivatives expressed 2) The protein encoded by this gene belongs to the basic helix-loop-helix family of transcription factors. This gene product is one of two closely related family members, the HAND proteins, which are asymmetrically expressed in the developing ventricular chambers and play an essential role in cardiac morphogenesis. Working in a complementary fashion, they function in the formation of the right ventricle and aortic arch arteries, implicating them as mediators of congenital heart disease. In addition, this transcription factor plays an important role in limb and branchial arch development. [provided by RefSeq, Jul 2008]

HAND2 links:

HAND2-AS1 (HGNC:48872): (HAND2 antisense RNA 1) Predicted to be involved in positive regulation of gene expression. Predicted to act upstream of or within with a positive effect on cardiac right ventricle morphogenesis. Predicted to act upstream of or within transcription elongation from RNA polymerase II promoter. Predicted to be located in chromatin; cytoplasm; and nucleoplasm. [provided by Alliance of Genome Resources, Apr 2022]

HAND2-AS1 links:

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Uncertain_significance. Variant got 2 ACMG points.

PM2

Very rare variant in population databases, with high coverage;

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
HAND2	NM_021973.3 link	c.269_320delCGGGCCTGGGGGGGCCGCGCCCGGTGAAGCGCCGAGGCACCGCCAACCGCAA	p.Pro90ArgfsTer70	frameshift_variant	Exon 1 of 2	ENST00000359562.4	NP_068808.1	P61296-1
HAND2-AS1	NR_136197.1 link	n.240+131_240+182delTTGCGGTTGGCGGTGCCTCGGCGCTTCACCGGGCGCGGCCCCCCCAGGCCCG		intron_variant	Intron 1 of 3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
HAND2	ENST00000359562.4 link	c.269_320delCGGGCCTGGGGGGGCCGCGCCCGGTGAAGCGCCGAGGCACCGCCAACCGCAA	p.Pro90ArgfsTer70	frameshift_variant	Exon 1 of 2	1	NM_021973.3	ENSP00000352565.4		P61296-1

Frequencies

GnomAD3 genomes

Cov.:

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome

Cov.:

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

LINK: link

Submissions by phenotype

not provided

Uncertain:1

Aug 10, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change creates a premature translational stop signal (p.Pro90Argfs*70) in the HAND2 gene. It is expected to result in an absent or disrupted protein product. However, the current clinical and genetic evidence is not sufficient to establish whether loss-of-function variants in HAND2 cause disease. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with HAND2-related conditions. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Name

Calibrated prediction

Score

Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.