NM_022081.6:c.949_972dupGCTTGTCCAGATGGCAGGAAGGAG

Variant names:

• chr22-26464657-T-TCTCCTTCCTGCCATCTGGACAAGC
• rs281865164
• NM_022081.6:c.949_972dupGCTTGTCCAGATGGCAGGAAGGAG

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_022081.6(HPS4):​c.949_972dupGCTTGTCCAGATGGCAGGAAGGAG​(p.Glu324_Asn325insAlaCysProAspGlyArgLysGlu) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000247 in 1,460,290 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★).

• Frequency:
  • Genomes: not found (cov: 33)
  • Exomes 𝑓: 0.000025 (0 hom.)
• Consequence: HPS4 NM_022081.6 conservative_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts P:1 U:3
• Conservation: PhyloP100: 0.981
• Publications: 3 publications found

Genes affected

HPS4 (HGNC:15844): (HPS4 biogenesis of lysosomal organelles complex 3 subunit 2) This gene encodes a protein component of biogenesis of lysosome-related organelles complexes (BLOC). BLOC complexes are important for the formation of endosomal-lysosomal organelles such as melanosomes and platelet dense granules. Mutations in this gene result in subtype 4 of Hermansky-Pudlak syndrome, a form of albinism. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]

HPS4 Gene-Disease associations (from GenCC):

• Hermansky-Pudlak syndrome 4

  Inheritance: AR Classification: DEFINITIVE, STRONG, MODERATE Submitted by: G2P, ClinGen, Labcorp Genetics (formerly Invitae), Ambry Genetics
• Hermansky-Pudlak syndrome with pulmonary fibrosis

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_022081.6.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
HPS4	NM_022081.6	c.949_972dupGCTTGTCCAGATGGCAGGAAGGAG	p.Glu324_Asn325insAlaCysProAspGlyArgLysGlu	conservative_inframe_insertion	Exon 11 of 14	ENST00000398145.7	NP_071364.4

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
HPS4	ENST00000398145.7	c.949_972dupGCTTGTCCAGATGGCAGGAAGGAG	p.Glu324_Asn325insAlaCysProAspGlyArgLysGlu	conservative_inframe_insertion	Exon 11 of 14	1	NM_022081.6	ENSP00000381213.2

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD2 exomes AF: 0.0000398 AC: 10 AN: 251226 AF XY: 0.0000221

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.0000792

Gnomad OTH exome AF: 0.000163

GnomAD4 exome AF: 0.0000247 AC: 36 AN: 1460290 Hom.: 0 Cov.: 34 AF XY: 0.0000234 AC XY: 17 AN XY: 726112

African (AFR) AF: 0.00 AC: 0 AN: 33452

American (AMR) AF: 0.00 AC: 0 AN: 44680

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26092

East Asian (EAS) AF: 0.00 AC: 0 AN: 39662

South Asian (SAS) AF: 0.00 AC: 0 AN: 86254

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53398

Middle Eastern (MID) AF: 0.000174 AC: 1 AN: 5762

European-Non Finnish (NFE) AF: 0.0000297 AC: 33 AN: 1110666

Other (OTH) AF: 0.0000332 AC: 2 AN: 60324

GnomAD4 genome Cov.: 33

Alfa AF: 0.0000508 Hom.: 0

Bravo AF: 0.00000378

EpiCase AF: 0.0000545

EpiControl AF: 0.0000593

ClinVar

Significance: Uncertain significance

Submissions summary: Pathogenic:1 Uncertain:3

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Hermansky-Pudlak syndrome 4 Pathogenic:1 Uncertain:1

Mar 01, 2002

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

Jan 24, 2023

Broad Center for Mendelian Genomics, Broad Institute of MIT and Harvard

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: curation

The p.Ala317_Glu324dup variant in HPS4 has been reported in 1 individual with Hermansky-Pudlak syndrome 4 (PMID: 11836498, 31898847) and has been identified in 0.008% (9/113628) of European (non-Finnish) chromosomes by the Genome Aggregation Database (gnomAD, http://gnomad.broadinstitute.org; dbSNP ID: rs281865164). Although this variant has been seen in the general population in a heterozygous state, its frequency is low enough to be consistent with a recessive carrier frequency. This variant has also been reported in ClinVar (Variation ID#: 4129) and has been interpreted as pathogenic by OMIM and as a variant of uncertain significance by Invitae. This variant is a duplication of 8 amino acids at position 317 and is not predicted to alter the protein reading-frame. It is unclear if this deletion will impact the protein. In summary, the clinical significance of the p.Ala317_Glu324dup variant is uncertain. ACMG/AMP Criteria applied: PM4, PM2_supporting (Richards 2015). -

not specified Uncertain:1

Dec 08, 2023

Women's Health and Genetics/Laboratory Corporation of America, LabCorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Variant summary: HPS4 c.949_972dup24 (p.Ala317_Glu324dup) results in an in-frame duplication that is predicted to duplicate 8 amino acids into the encoded protein. The variant allele was found at a frequency of 4e-05 in 251226 control chromosomes (gnomAD). This frequency is not significantly higher than estimated for a pathogenic variant in HPS4 causing Hermansky-Pudlak Syndrome (4e-05 vs 0.00052), allowing no conclusion about variant significance. c.949_972dup24 has been reported in the literature in related heterozygous individuals affected with Hermansky-Pudlak Syndrome without a second variant identified (Suzuki_2002). These data do not allow any conclusion about variant significance. To our knowledge, no experimental evidence demonstrating an impact on protein function has been reported. The following publication has been ascertained in the context of this evaluation (PMID: 11836498). Two submitters have cited clinical-significance assessments for this variant to ClinVar after 2014. Both submitters classified the variant as uncertain significance. Based on the evidence outlined above, the variant was classified as uncertain significance. -

not provided Uncertain:1

Apr 08, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.949_972dup, results in the insertion of 8 amino acid(s) of the HPS4 protein (p.Ala317_Glu324dup), but otherwise preserves the integrity of the reading frame. This variant is present in population databases (rs281865164, gnomAD 0.007%). This variant has not been reported in the literature in individuals affected with HPS4-related conditions. ClinVar contains an entry for this variant (Variation ID: 4129). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.98
Mutation Taster		=73/27	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs281865164; hg19: chr22-26860623;