NM_022081.6:c.949_972dupGCTTGTCCAGATGGCAGGAAGGAG

Variant names:

• chr22-26464657-T-TCTCCTTCCTGCCATCTGGACAAGC
• rs281865164
• NM_022081.6:c.949_972dupGCTTGTCCAGATGGCAGGAAGGAG

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_022081.6(HPS4):​c.949_972dupGCTTGTCCAGATGGCAGGAAGGAG​(p.Glu324_Asn325insAlaCysProAspGlyArgLysGlu) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000247 in 1,460,290 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★).

• Frequency:
  • Genomes: not found (cov: 33)
  • Exomes 𝑓: 0.000025 (0 hom.)
• Consequence: HPS4 NM_022081.6 conservative_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, multiple submitters, no conflicts P:1 U:3
• Conservation: PhyloP100: 0.981
• Publications: 3 publications found

Genes affected

HPS4 (HGNC:15844): (HPS4 biogenesis of lysosomal organelles complex 3 subunit 2) This gene encodes a protein component of biogenesis of lysosome-related organelles complexes (BLOC). BLOC complexes are important for the formation of endosomal-lysosomal organelles such as melanosomes and platelet dense granules. Mutations in this gene result in subtype 4 of Hermansky-Pudlak syndrome, a form of albinism. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]

HPS4 Gene-Disease associations (from GenCC):

• Hermansky-Pudlak syndrome 4

  Inheritance: AR Classification: DEFINITIVE, STRONG, MODERATE Submitted by: G2P, ClinGen, Labcorp Genetics (formerly Invitae), Ambry Genetics
• Hermansky-Pudlak syndrome with pulmonary fibrosis

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_022081.6.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_022081.6. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	HPS4	NM_022081.6	MANE Select	c.949_972dupGCTTGTCCAGATGGCAGGAAGGAG	p.Glu324_Asn325insAlaCysProAspGlyArgLysGlu	conservative_inframe_insertion	Exon 11 of 14	NP_071364.4
	HPS4	NM_001349900.2		c.1003_1026dupGCTTGTCCAGATGGCAGGAAGGAG	p.Glu342_Asn343insAlaCysProAspGlyArgLysGlu	conservative_inframe_insertion	Exon 12 of 15	NP_001336829.1
	HPS4	NM_001349901.1		c.1003_1026dupGCTTGTCCAGATGGCAGGAAGGAG	p.Glu342_Asn343insAlaCysProAspGlyArgLysGlu	conservative_inframe_insertion	Exon 12 of 15	NP_001336830.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	HPS4	ENST00000398145.7	TSL:1 MANE Select	c.949_972dupGCTTGTCCAGATGGCAGGAAGGAG	p.Glu324_Asn325insAlaCysProAspGlyArgLysGlu	conservative_inframe_insertion	Exon 11 of 14	ENSP00000381213.2
	HPS4	ENST00000402105.7	TSL:1	c.934_957dupGCTTGTCCAGATGGCAGGAAGGAG	p.Glu319_Asn320insAlaCysProAspGlyArgLysGlu	conservative_inframe_insertion	Exon 9 of 12	ENSP00000384185.3
	HPS4	ENST00000439453.5	TSL:1	n.*467_*490dupGCTTGTCCAGATGGCAGGAAGGAG		non_coding_transcript_exon	Exon 11 of 14	ENSP00000406764.1

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD2 exomes AF: 0.0000398 AC: 10 AN: 251226 AF XY: 0.0000221

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.0000792

Gnomad OTH exome AF: 0.000163

GnomAD4 exome AF: 0.0000247 AC: 36 AN: 1460290 Hom.: 0 Cov.: 34 AF XY: 0.0000234 AC XY: 17 AN XY: 726112

African (AFR) AF: 0.00 AC: 0 AN: 33452

American (AMR) AF: 0.00 AC: 0 AN: 44680

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26092

East Asian (EAS) AF: 0.00 AC: 0 AN: 39662

South Asian (SAS) AF: 0.00 AC: 0 AN: 86254

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53398

Middle Eastern (MID) AF: 0.000174 AC: 1 AN: 5762

European-Non Finnish (NFE) AF: 0.0000297 AC: 33 AN: 1110666

Other (OTH) AF: 0.0000332 AC: 2 AN: 60324

GnomAD4 genome Cov.: 33

Alfa AF: 0.0000508 Hom.: 0

Bravo AF: 0.00000378

EpiCase AF: 0.0000545

EpiControl AF: 0.0000593

ClinVar

ClinVar submissions as Germline

Significance: Uncertain significance

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
1	1	-	Hermansky-Pudlak syndrome 4 (2)
-	1	-	not provided (1)
-	1	-	not specified (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.98
Mutation Taster		=73/27	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs281865164; hg19: chr22-26860623;