NM_030665.4:c.852_872dupGCAGCAGCAGCAGCAGCAGCA
Variant summary
Our verdict is Likely benign. Variant got -1 ACMG points: 0P and 1B. BP6
The NM_030665.4(RAI1):c.852_872dupGCAGCAGCAGCAGCAGCAGCA(p.Gln285_Gln291dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).
Frequency
Consequence
NM_030665.4 disruptive_inframe_insertion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Likely_benign. Variant got -1 ACMG points.
Transcripts
RefSeq
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
RAI1 | ENST00000353383.6 | c.852_872dupGCAGCAGCAGCAGCAGCAGCA | p.Gln285_Gln291dup | disruptive_inframe_insertion | Exon 3 of 6 | 1 | NM_030665.4 | ENSP00000323074.4 | ||
RAI1 | ENST00000395774.1 | c.852_872dupGCAGCAGCAGCAGCAGCAGCA | p.Gln285_Gln291dup | disruptive_inframe_insertion | Exon 2 of 2 | 2 | ENSP00000379120.1 |
Frequencies
GnomAD3 genomes AF: 0.0000381 AC: 3AN: 78832Hom.: 0 Cov.: 0
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000109 AC: 14AN: 1278808Hom.: 0 Cov.: 38 AF XY: 0.00000949 AC XY: 6AN XY: 632488
GnomAD4 genome AF: 0.0000381 AC: 3AN: 78832Hom.: 0 Cov.: 0 AF XY: 0.00 AC XY: 0AN XY: 37424
ClinVar
Submissions by phenotype
RAI1-related disorder Uncertain:1
The RAI1 c.852_872dup21 variant is predicted to result in an in-frame duplication (p.Gln285_Gln291dup). This variant occurs in a poly-glutamine repeat track in exon 3 of RAI1. To our knowledge, this variant has not been reported in the literature or in a large population database (http://gnomad.broadinstitute.org), indicating this variant is rare. At this time, the clinical significance of this variant is uncertain due to the absence of conclusive functional and genetic evidence. -
not provided Benign:1
- -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at