NM_032520.5:c.609+28_610-16delGTGGGCCTGGCTGGGAGCTGGGTGCTGCCCCTGC
Variant summary
Our verdict is Uncertain significance. The variant received 1 ACMG points: 1P and 0B. PP5
The NM_032520.5(GNPTG):c.609+28_610-16delGTGGGCCTGGCTGGGAGCTGGGTGCTGCCCCTGC variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars).
Frequency
Consequence
NM_032520.5 intron
Scores
Clinical Significance
Conservation
Publications
- GNPTG-mucolipidosisInheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, G2P, Myriad Women's Health, Genomics England PanelApp, ClinGen, Labcorp Genetics (formerly Invitae)
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 1 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_032520.5. You can select a different transcript below to see updated ACMG assignments.
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| GNPTG | TSL:1 MANE Select | c.609+28_610-16delGTGGGCCTGGCTGGGAGCTGGGTGCTGCCCCTGC | intron | N/A | ENSP00000204679.4 | Q9UJJ9 | |||
| GNPTG | c.729+28_730-16delGTGGGCCTGGCTGGGAGCTGGGTGCTGCCCCTGC | intron | N/A | ENSP00000561851.1 | |||||
| GNPTG | TSL:2 | c.693+28_694-16delGTGGGCCTGGCTGGGAGCTGGGTGCTGCCCCTGC | intron | N/A | ENSP00000435349.2 | H0YEA7 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 genome Cov.: 33
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.