NM_032545.4:c.361_362+18dupAGGTGGGCACAGGGGTGCGC

Variant names:

• chr2-130597849-C-CGCGCACCCCTGTGCCCACCT
• rs863223280
• NM_032545.4:c.361_362+18dupAGGTGGGCACAGGGGTGCGC

Variant summary

Our verdict is Uncertain significance. The variant received 1 ACMG points: 1P and 0B. PP5

The NM_032545.4(CFC1):​c.361_362+18dupAGGTGGGCACAGGGGTGCGC variant causes a intron change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars).

• Frequency:
  • Genomes: not found (cov: 0)
  • Exomes 𝑓: 0.0 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: CFC1 NM_032545.4 intron
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: -0.0490
• Publications: 0 publications found

Genes affected

CFC1 (HGNC:18292): (cryptic, EGF-CFC family member 1) This gene encodes a member of the epidermal growth factor (EGF)- Cripto, Frl-1, and Cryptic (CFC) family, which are involved in signalling during embryonic development. Proteins in this family share a variant EGF-like motif, a conserved cysteine-rich domain, and a C-terminal hydrophobic region. The protein encoded by this gene is necessary for patterning the left-right embryonic axis. Mutations in this gene are associated with defects in organ development, including autosomal visceral heterotaxy and congenital heart disease. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]

CFC1 Gene-Disease associations (from GenCC):

• heterotaxy, visceral, 2, autosomal

  Inheritance: AD Classification: STRONG, LIMITED Submitted by: PanelApp Australia, Ambry Genetics, G2P, Labcorp Genetics (formerly Invitae)

ENSG00000296255 (HGNC:):

ACMG classification

Our verdict: Uncertain_significance. The variant received 1 ACMG points.

• PP5: Variant 2-130597849-C-CGCGCACCCCTGTGCCCACCT is Pathogenic according to our data. Variant chr2-130597849-C-CGCGCACCCCTGTGCCCACCT is described in ClinVar as Pathogenic. ClinVar VariationId is 5190.Status of the report is no_assertion_criteria_provided, 0 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_032545.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CFC1	NM_032545.4	MANE Select	c.361_362+18dupAGGTGGGCACAGGGGTGCGC		intron	N/A	NP_115934.1
	CFC1	NM_001270420.2		c.248-266_248-247dupAGGTGGGCACAGGGGTGCGC		intron	N/A	NP_001257349.1
	CFC1	NM_001270421.2		c.247+773_247+792dupAGGTGGGCACAGGGGTGCGC		intron	N/A	NP_001257350.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CFC1	ENST00000259216.6	TSL:1 MANE Select	c.362+18_362+19insAGGTGGGCACAGGGGTGCGC		intron	N/A	ENSP00000259216.5
	CFC1	ENST00000615342.4	TSL:5	c.248-247_248-246insAGGTGGGCACAGGGGTGCGC		intron	N/A	ENSP00000480526.1
	CFC1	ENST00000621673.4	TSL:2	c.247+792_247+793insAGGTGGGCACAGGGGTGCGC		intron	N/A	ENSP00000480843.1

Frequencies

GnomAD3 genomes Cov.: 0

GnomAD4 exome Data not reliable, filtered out with message: AC0 AF: 0.00 AC: 0 AN: 664 Hom.: 0 Cov.: 0 AF XY: 0.00 AC XY: 0 AN XY: 324

African (AFR) AF: 0.00 AC: 0 AN: 22

American (AMR) AF: 0.00 AC: 0 AN: 16

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 30

East Asian (EAS) AF: 0.00 AC: 0 AN: 10

South Asian (SAS) AF: 0.00 AC: 0 AN: 6

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 6

Middle Eastern (MID) AC: 0 AN: 0

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 532

Other (OTH) AF: 0.00 AC: 0 AN: 42

GnomAD4 genome Cov.: 0

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

Heterotaxy, visceral, 2, autosomal Pathogenic:1

Mar 01, 2002

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		-0.049
Mutation Taster		=39/61	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs863223280; hg19: chr2-131355422;