NM_133433.4:c.7701_7725delCTCTCCATCTGAATCTGCAAAAGTA

Variant names:

• chr5-37060853-GAAGTACTCTCCATCTGAATCTGCAA-G
• rs587784047
• NM_133433.4:c.7701_7725delCTCTCCATCTGAATCTGCAAAAGTA

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_133433.4(NIPBL):​c.7701_7725delCTCTCCATCTGAATCTGCAAAAGTA​(p.Ser2568MetfsTer5) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: NIPBL NM_133433.4 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 8.95
• Publications: 1 publications found

Genes affected

NIPBL (HGNC:28862): (NIPBL cohesin loading factor) This gene encodes the homolog of the Drosophila melanogaster Nipped-B gene product and fungal Scc2-type sister chromatid cohesion proteins. The Drosophila protein facilitates enhancer-promoter communication of remote enhancers and plays a role in developmental regulation. It is also homologous to a family of chromosomal adherins with broad roles in sister chromatid cohesion, chromosome condensation, and DNA repair. The human protein has a bipartite nuclear targeting sequence and a putative HEAT repeat. Condensins, cohesins and other complexes with chromosome-related functions also contain HEAT repeats. Mutations in this gene result in Cornelia de Lange syndrome, a disorder characterized by dysmorphic facial features, growth delay, limb reduction defects, and cognitive disability. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

NIPBL Gene-Disease associations (from GenCC):

• Cornelia de Lange syndrome

  Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
• Cornelia de Lange syndrome 1

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 5-37060853-GAAGTACTCTCCATCTGAATCTGCAA-G is Pathogenic according to our data. Variant chr5-37060853-GAAGTACTCTCCATCTGAATCTGCAA-G is described in CliVar as Pathogenic. Clinvar id is 159234.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr5-37060853-GAAGTACTCTCCATCTGAATCTGCAA-G is described in CliVar as Pathogenic. Clinvar id is 159234.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr5-37060853-GAAGTACTCTCCATCTGAATCTGCAA-G is described in CliVar as Pathogenic. Clinvar id is 159234.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr5-37060853-GAAGTACTCTCCATCTGAATCTGCAA-G is described in CliVar as Pathogenic. Clinvar id is 159234.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr5-37060853-GAAGTACTCTCCATCTGAATCTGCAA-G is described in CliVar as Pathogenic. Clinvar id is 159234.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr5-37060853-GAAGTACTCTCCATCTGAATCTGCAA-G is described in CliVar as Pathogenic. Clinvar id is 159234.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr5-37060853-GAAGTACTCTCCATCTGAATCTGCAA-G is described in CliVar as Pathogenic. Clinvar id is 159234.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
NIPBL	NM_133433.4	c.7701_7725delCTCTCCATCTGAATCTGCAAAAGTA	p.Ser2568MetfsTer5	frameshift_variant	Exon 45 of 47	ENST00000282516.13	NP_597677.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
NIPBL	ENST00000282516.13	c.7701_7725delCTCTCCATCTGAATCTGCAAAAGTA	p.Ser2568MetfsTer5	frameshift_variant	Exon 45 of 47	1	NM_133433.4	ENSP00000282516.8

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Cornelia de Lange syndrome 1 Pathogenic:1

Feb 08, 2013

Genetic Services Laboratory, University of Chicago

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		8.9
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs587784047; hg19: chr5-37060955;