NM_207319.4:c.2075_2140delTAGTTATGCCACCACTGGAAGATGACGATGAATTTATGGAGACCAAAAGAACCCAAGAAGGAGAAG

Variant names:

• chrX-27461156-GCTTCTCCTTCTTGGGTTCTTTTGGTCTCCATAAATTCATCGTCATCTTCCAGTGGTGGCATAACTA-G
• rs1569127888
• NM_207319.4:c.2075_2140delTAGTTATGCCACCACTGGAAGATGACGATGAATTTATGGAGACCAAAAGAACCCAAGAAGGAGAAG

Variant summary

Our verdict is Likely benign. The variant received -4 ACMG points: 2P and 6B. PM4 BP6_Moderate BS2

The NM_207319.4(PPP4R3C):​c.2075_2140delTAGTTATGCCACCACTGGAAGATGACGATGAATTTATGGAGACCAAAAGAACCCAAGAAGGAGAAG​(p.Val692_Glu713del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000996 in 401,577 control chromosomes in the GnomAD database, with no homozygous occurrence. There are 4 hemizygotes in GnomAD. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★).

• Frequency:
  • Genomes: not found (cov: 22)
  • Exomes 𝑓: 0.000010 (0 hom. 4 hem.)
• Consequence: PPP4R3C NM_207319.4 disruptive_inframe_deletion
• Clinical Significance: Likely benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 2.00
• Publications: 0 publications found

Genes affected

PPP4R3C (HGNC:33146): (protein phosphatase 4 regulatory subunit 3C)

ACMG classification

Our verdict: Likely_benign. The variant received -4 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_207319.4.
• BP6: Variant X-27461156-GCTTCTCCTTCTTGGGTTCTTTTGGTCTCCATAAATTCATCGTCATCTTCCAGTGGTGGCATAACTA-G is Benign according to our data. Variant chrX-27461156-GCTTCTCCTTCTTGGGTTCTTTTGGTCTCCATAAATTCATCGTCATCTTCCAGTGGTGGCATAACTA-G is described in ClinVar as Likely_benign. ClinVar VariationId is 3771192.Status of the report is criteria_provided_single_submitter, 1 stars.
• BS2: High Hemizygotes in GnomAdExome4 at 4 gene

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_207319.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PPP4R3C	NM_207319.4	MANE Select	c.2075_2140delTAGTTATGCCACCACTGGAAGATGACGATGAATTTATGGAGACCAAAAGAACCCAAGAAGGAGAAG	p.Val692_Glu713del	disruptive_inframe_deletion	Exon 1 of 1	NP_997202.3

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PPP4R3C	ENST00000412172.4	TSL:6 MANE Select	c.2075_2140delTAGTTATGCCACCACTGGAAGATGACGATGAATTTATGGAGACCAAAAGAACCCAAGAAGGAGAAG	p.Val692_Glu713del	disruptive_inframe_deletion	Exon 1 of 1	ENSP00000489770.1	Q6ZMV5-1

Frequencies

GnomAD3 genomes Cov.: 22

GnomAD2 exomes AF: 0.0000200 AC: 2 AN: 99861 AF XY: 0.0000539

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.000128

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.00000996 AC: 4 AN: 401577 Hom.: 0 AF XY: 0.0000268 AC XY: 4 AN XY: 149021

African (AFR) AF: 0.00 AC: 0 AN: 12498

American (AMR) AF: 0.00 AC: 0 AN: 27082

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 14666

East Asian (EAS) AF: 0.0000415 AC: 1 AN: 24103

South Asian (SAS) AF: 0.0000264 AC: 1 AN: 37875

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 25645

Middle Eastern (MID) AF: 0.000335 AC: 1 AN: 2984

European-Non Finnish (NFE) AF: 0.00000428 AC: 1 AN: 233588

Other (OTH) AF: 0.00 AC: 0 AN: 23136

GnomAD4 genome Cov.: 22

ClinVar

ClinVar submissions

Significance: Likely benign

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	-	1	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.0

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1569127888; hg19: chrX-27479273;