rs2083150642
Variant summary
Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM2
The NM_014467.3(SRPX2):c.112_163+10dupAATGAAGTATATGCAGAGGAGGTCCCACAGGCTCCTGCCCTGGACTACCGAGGTAATCTACC variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_014467.3 intron
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 2 ACMG points.
Transcripts
RefSeq
Ensembl
Frequencies
GnomAD3 genomes Cov.: 22
GnomAD4 exome Cov.: 29
GnomAD4 genome Cov.: 22
ClinVar
Submissions by phenotype
Rolandic epilepsy, intellectual disability, and speech dyspraxia, X-linked Uncertain:1
This variant has not been reported in the literature in individuals with SRPX2-related conditions. This sequence change falls in intron 3 of the SRPX2 gene. It does not directly change the encoded amino acid sequence of the SRPX2 protein. This variant is not present in population databases (ExAC no frequency). Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may create or strengthen a splice site, but this prediction has not been confirmed by published transcriptional studies. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at