X-112779389-GCTGGAGCAGCAGCAGCAGCAACAGCAA-GCTGGAGCAGCAGCAGCAGCAACAGCAACTGGAGCAGCAGCAGCAGCAACAGCAA

Variant names:

• chrX-112779389-G-GCTGGAGCAGCAGCAGCAGCAACAGCAA
• NM_001113490.2:c.2738_2764dupTTGCTGTTGCTGCTGCTGCTGCTCCAG

Variant summary

Our verdict is Uncertain significance. Variant got 1 ACMG points: 2P and 1B. PM2 BP3

The NM_001113490.2(AMOT):​c.2738_2764dupTTGCTGTTGCTGCTGCTGCTGCTCCAG​(p.Val913_Pro921dup) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000413 in 968,529 control chromosomes in the GnomAD database, with no homozygous occurrence. There are 1 hemizygotes in GnomAD. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: not found (cov: 22)
  • Exomes 𝑓: 0.0000041 (0 hom. 1 hem.)
• Consequence: AMOT NM_001113490.2 conservative_inframe_insertion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.873

Genes affected

AMOT (HGNC:17810): (angiomotin) This gene belongs to the motin family of angiostatin binding proteins characterized by conserved coiled-coil domains and C-terminal PDZ binding motifs. The encoded protein is expressed predominantly in endothelial cells of capillaries as well as larger vessels of the placenta where it may mediate the inhibitory effect of angiostatin on tube formation and the migration of endothelial cells toward growth factors during the formation of new blood vessels. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Uncertain_significance. Variant got 1 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• BP3: Nonframeshift variant in repetitive region in NM_001113490.2

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
AMOT	NM_001113490.2	c.2738_2764dupTTGCTGTTGCTGCTGCTGCTGCTCCAG	p.Val913_Pro921dup	conservative_inframe_insertion	Exon 13 of 14	ENST00000371959.9	NP_001106962.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
AMOT	ENST00000371959.9	c.2738_2764dupTTGCTGTTGCTGCTGCTGCTGCTCCAG	p.Val913_Pro921dup	conservative_inframe_insertion	Exon 13 of 14	1	NM_001113490.2	ENSP00000361027.3
AMOT	ENST00000371962.5	c.2042_2068dupTTGCTGTTGCTGCTGCTGCTGCTCCAG	p.Val681_Pro689dup	conservative_inframe_insertion	Exon 10 of 11	1		ENSP00000361030.1
AMOT	ENST00000304758.5	c.1511_1537dupTTGCTGTTGCTGCTGCTGCTGCTCCAG	p.Val504_Pro512dup	conservative_inframe_insertion	Exon 11 of 12	1		ENSP00000305557.1

Frequencies

GnomAD3 genomes Cov.: 22

GnomAD4 exome AF: 0.00000413 AC: 4 AN: 968529 Hom.: 0 Cov.: 19 AF XY: 0.00000348 AC XY: 1 AN XY: 286983

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000540

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 22

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chrX-112022617;