X-112779450-TGGCAGCAGTGGCAGTGATGGC-TGGCAGCAGTGGCAGTGATGGCGGCAGCAGTGGCAGTGATGGC

Variant names:

• chrX-112779450-T-TGGCAGCAGTGGCAGTGATGGC
• rs752098156
• NM_001113490.2:c.2683_2703dupGCCATCACTGCCACTGCTGCC

Variant summary

Our verdict is Likely benign. Variant got -5 ACMG points: 0P and 5B. BP3 BS2

The NM_001113490.2(AMOT):​c.2683_2703dupGCCATCACTGCCACTGCTGCC​(p.Ala901_Thr902insAlaIleThrAlaThrAlaAla) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000226 in 1,193,614 control chromosomes in the GnomAD database, with no homozygous occurrence. There are 8 hemizygotes in GnomAD. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.0000090 (0 hom., 0 hem., cov: 23)
  • Exomes 𝑓: 0.000024 (0 hom. 8 hem.)
• Consequence: AMOT NM_001113490.2 conservative_inframe_insertion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 1.61

Genes affected

AMOT (HGNC:17810): (angiomotin) This gene belongs to the motin family of angiostatin binding proteins characterized by conserved coiled-coil domains and C-terminal PDZ binding motifs. The encoded protein is expressed predominantly in endothelial cells of capillaries as well as larger vessels of the placenta where it may mediate the inhibitory effect of angiostatin on tube formation and the migration of endothelial cells toward growth factors during the formation of new blood vessels. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Likely_benign. Variant got -5 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_001113490.2
• BS2: High Hemizygotes in GnomAdExome4 at 8 gene

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
AMOT	NM_001113490.2	c.2683_2703dupGCCATCACTGCCACTGCTGCC	p.Ala901_Thr902insAlaIleThrAlaThrAlaAla	conservative_inframe_insertion	Exon 13 of 14	ENST00000371959.9	NP_001106962.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
AMOT	ENST00000371959.9	c.2683_2703dupGCCATCACTGCCACTGCTGCC	p.Ala901_Thr902insAlaIleThrAlaThrAlaAla	conservative_inframe_insertion	Exon 13 of 14	1	NM_001113490.2	ENSP00000361027.3
AMOT	ENST00000371962.5	c.1987_2007dupGCCATCACTGCCACTGCTGCC	p.Ala669_Thr670insAlaIleThrAlaThrAlaAla	conservative_inframe_insertion	Exon 10 of 11	1		ENSP00000361030.1
AMOT	ENST00000304758.5	c.1456_1476dupGCCATCACTGCCACTGCTGCC	p.Ala492_Thr493insAlaIleThrAlaThrAlaAla	conservative_inframe_insertion	Exon 11 of 12	1		ENSP00000305557.1

Frequencies

GnomAD3 genomes AF: 0.00000896 AC: 1 AN: 111557 Hom.: 0 Cov.: 23 AF XY: 0.00 AC XY: 0 AN XY: 33795

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00422

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.0000240 AC: 26 AN: 1082057 Hom.: 0 Cov.: 30 AF XY: 0.0000227 AC XY: 8 AN XY: 351871

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.0000252

Gnomad4 OTH exome AF: 0.0000220

GnomAD4 genome AF: 0.00000896 AC: 1 AN: 111557 Hom.: 0 Cov.: 23 AF XY: 0.00 AC XY: 0 AN XY: 33795

Gnomad4 AFR AF: 0.00

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.00

Gnomad4 OTH AF: 0.00

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs752098156; hg19: chrX-112022678;