X-133753859-CCTGGGTCATAATAAGCTTGGGGAAAT-CTGCAAG
Variant summary
Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1PM2PP5_Moderate
The ENST00000370818.8(GPC3):c.629_654delATTTCCCCAAGCTTATTATGACCCAGinsCTTGCA(p.Asn210fs) variant causes a frameshift, missense change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.
Frequency
Genomes: not found (cov: 22)
Consequence
GPC3
ENST00000370818.8 frameshift, missense
ENST00000370818.8 frameshift, missense
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: 9.60
Genes affected
GPC3 (HGNC:4451): (glypican 3) Cell surface heparan sulfate proteoglycans are composed of a membrane-associated protein core substituted with a variable number of heparan sulfate chains. Members of the glypican-related integral membrane proteoglycan family (GRIPS) contain a core protein anchored to the cytoplasmic membrane via a glycosyl phosphatidylinositol linkage. These proteins may play a role in the control of cell division and growth regulation. The protein encoded by this gene can bind to and inhibit the dipeptidyl peptidase activity of CD26, and it can induce apoptosis in certain cell types. Deletion mutations in this gene are associated with Simpson-Golabi-Behmel syndrome, also known as Simpson dysmorphia syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Pathogenic. Variant got 12 ACMG points.
PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant X-133753860-CTGGGTCATAATAAGCTTGGGGAAAT-TGCAAG is Pathogenic according to our data. Variant chrX-133753860-CTGGGTCATAATAAGCTTGGGGAAAT-TGCAAG is described in ClinVar as [Pathogenic]. Clinvar id is 476661.Status of the report is criteria_provided_single_submitter, 1 stars.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
GPC3 | NM_004484.4 | c.629_654delATTTCCCCAAGCTTATTATGACCCAGinsCTTGCA | p.Asn210fs | frameshift_variant, missense_variant | 3/8 | ENST00000370818.8 | NP_004475.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
GPC3 | ENST00000370818.8 | c.629_654delATTTCCCCAAGCTTATTATGACCCAGinsCTTGCA | p.Asn210fs | frameshift_variant, missense_variant | 3/8 | 1 | NM_004484.4 | ENSP00000359854.3 |
Frequencies
GnomAD3 genomes Cov.: 22
GnomAD3 genomes
Cov.:
22
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome Cov.: 22
GnomAD4 genome
Cov.:
22
ClinVar
Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link
Submissions by phenotype
Wilms tumor 1 Pathogenic:1
Pathogenic, criteria provided, single submitter | clinical testing | Labcorp Genetics (formerly Invitae), Labcorp | Mar 13, 2017 | While this particular variant has not been reported in the literature, loss-of-function variants in GPC3 are known to be pathogenic (PMID: 10814714, 17603795). For these reasons, this variant has been classified as Pathogenic. This sequence change deletes 26 nucleotides and inserts 6 nucleotides in exon 3 of the GPC3 mRNA (c.629_654delinsCTTGCA), causing a frameshift at codon 210. This creates a premature translational stop signal (p.Asn210Thrfs*11) and is expected to result in an absent or disrupted protein product. - |
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at