X-134460324-AGCCCTGGCGTCGTGGTGAGCAGCTCGGCCTGCCG-A

Variant summary

Our verdict is Likely pathogenic. The variant received 6 ACMG points: 6P and 0B. PVS1_StrongPP5_Moderate

The NM_000194.3(HPRT1):​c.22_27+28delGTCGTGGTGAGCAGCTCGGCCTGCCGGCCCTGGC​(p.Val8_Val9del) variant causes a splice donor, conservative inframe deletion, splice region, intron change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. V8V) has been classified as Likely benign.

Frequency

Genomes: not found (cov: 24)

Consequence

HPRT1
NM_000194.3 splice_donor, conservative_inframe_deletion, splice_region, intron

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, single submitter P:1

Conservation

PhyloP100: 3.86
Variant links:
Genes affected
HPRT1 (HGNC:5157): (hypoxanthine phosphoribosyltransferase 1) The protein encoded by this gene is a transferase, which catalyzes conversion of hypoxanthine to inosine monophosphate and guanine to guanosine monophosphate via transfer of the 5-phosphoribosyl group from 5-phosphoribosyl 1-pyrophosphate. This enzyme plays a central role in the generation of purine nucleotides through the purine salvage pathway. Mutations in this gene result in Lesch-Nyhan syndrome or gout.[provided by RefSeq, Jun 2009]

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Likely_pathogenic. The variant received 6 ACMG points.

PVS1
Splicing +-2 bp (donor or acceptor) variant, product NOT destroyed by NMD, known LOF gene, truncates exone, which is 0.2648402 fraction of the gene. No cryptic splice site detected. Exon removal is inframe change.
PP5
Variant X-134460324-AGCCCTGGCGTCGTGGTGAGCAGCTCGGCCTGCCG-A is Pathogenic according to our data. Variant chrX-134460324-AGCCCTGGCGTCGTGGTGAGCAGCTCGGCCTGCCG-A is described in ClinVar as [Pathogenic]. Clinvar id is 842633.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
HPRT1NM_000194.3 linkc.22_27+28delGTCGTGGTGAGCAGCTCGGCCTGCCGGCCCTGGC p.Val8_Val9del splice_donor_variant, conservative_inframe_deletion, splice_region_variant, intron_variant Exon 1 of 9 ENST00000298556.8 NP_000185.1 P00492A0A140VJL3

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
HPRT1ENST00000298556.8 linkc.14_27+20delGCCCTGGCGTCGTGGTGAGCAGCTCGGCCTGCCG p.Ser5IlefsTer26 frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant Exon 1 of 9 1 NM_000194.3 ENSP00000298556.7 P00492
HPRT1ENST00000462974.5 linkn.-26_8delGCCCTGGCGTCGTGGTGAGCAGCTCGGCCTGCCG non_coding_transcript_exon_variant Exon 1 of 8 3
HPRT1ENST00000462974.5 linkn.-26_8delGCCCTGGCGTCGTGGTGAGCAGCTCGGCCTGCCG upstream_gene_variant 3

Frequencies

GnomAD3 genomes
Cov.:
24
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
24

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Lesch-Nyhan syndrome;C0268117:Partial hypoxanthine-guanine phosphoribosyltransferase deficiency Pathogenic:1
Dec 24, 2019
Labcorp Genetics (formerly Invitae), Labcorp
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

This variant disrupts the c.27+5 nucleotide in the HPRT1 gene. Other variant(s) that disrupt this nucleotide have been determined to be pathogenic (PMID: 17027311). This suggests that this nucleotide is clinically-significant, and that variants that disrupt this position are likely to be disease-causing. Loss-of-function variants in HPRT1 are known to be pathogenic (PMID: 15571220, 17027311, 22157001). For these reasons, this variant has been classified as Pathogenic. This variant results in the deletion of part of exon 1 (c.22_27+28del) of the HPRT1 gene. It is expected to disrupt RNA splicing and likely results in an absent or disrupted protein product. The frequency data for this variant in the population databases is considered unreliable, as metrics indicate insufficient coverage at this position in the ExAC database. This variant has not been reported in the literature in individuals with HPRT1-related conditions. Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may disrupt the consensus splice site, but this prediction has not been confirmed by published transcriptional studies. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
3.9
Mutation Taster
=4/196
disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs2077579380; hg19: chrX-133594354; API