X-154030626-CTGGTGGGGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGTGGGGGCAGGGGTGGGAGCAGTGGCACGGGGGCCTTTGGGGACTCTGAGTGGTGGTGATGGTGGTGGTG-C
Variant summary
Our verdict is Likely pathogenic. Variant got 8 ACMG points: 8P and 0B. PVS1
The NM_001110792.2(MECP2):c.1132_1237del(p.His378AlafsTer8) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. H378H) has been classified as Likely benign.
Frequency
Genomes: not found (cov: 17)
Consequence
MECP2
NM_001110792.2 frameshift
NM_001110792.2 frameshift
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: 3.50
Genes affected
MECP2 (HGNC:6990): (methyl-CpG binding protein 2) DNA methylation is the major modification of eukaryotic genomes and plays an essential role in mammalian development. Human proteins MECP2, MBD1, MBD2, MBD3, and MBD4 comprise a family of nuclear proteins related by the presence in each of a methyl-CpG binding domain (MBD). Each of these proteins, with the exception of MBD3, is capable of binding specifically to methylated DNA. MECP2, MBD1 and MBD2 can also repress transcription from methylated gene promoters. In contrast to other MBD family members, MECP2 is X-linked and subject to X inactivation. MECP2 is dispensible in stem cells, but is essential for embryonic development. MECP2 gene mutations are the cause of most cases of Rett syndrome, a progressive neurologic developmental disorder and one of the most common causes of cognitive disability in females. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2015]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Likely_pathogenic. Variant got 8 ACMG points.
PVS1
Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. There are 70 pathogenic variants in the truncated region.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | MANE | UniProt |
---|---|---|---|---|---|---|---|
MECP2 | NM_001110792.2 | c.1132_1237del | p.His378AlafsTer8 | frameshift_variant | 3/3 | ENST00000453960.7 | |
MECP2 | NM_004992.4 | c.1096_1201del | p.His366AlafsTer8 | frameshift_variant | 4/4 | ENST00000303391.11 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | TSL | MANE | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|
MECP2 | ENST00000303391.11 | c.1096_1201del | p.His366AlafsTer8 | frameshift_variant | 4/4 | 1 | NM_004992.4 | P1 | |
MECP2 | ENST00000453960.7 | c.1132_1237del | p.His378AlafsTer8 | frameshift_variant | 3/3 | 1 | NM_001110792.2 | ||
MECP2 | ENST00000407218.5 | c.*468_*573del | 3_prime_UTR_variant | 4/4 | 5 | ||||
MECP2 | ENST00000628176.2 | c.*468_*573del | 3_prime_UTR_variant | 5/5 | 3 |
Frequencies
GnomAD3 genomes Cov.: 17
GnomAD3 genomes
Cov.:
17
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome Cov.: 17
GnomAD4 genome
Cov.:
17
ClinVar
Significance: Uncertain significance
Submissions summary: Pathogenic:1Uncertain:1
Revision: criteria provided, single submitter
LINK: link
Submissions by phenotype
Rett syndrome Pathogenic:1Uncertain:1
Pathogenic, no assertion criteria provided | curation | RettBASE | Sep 05, 2002 | - - |
Uncertain significance, criteria provided, single submitter | curation | Centre for Population Genomics, CPG | Mar 18, 2024 | This variant has been collected from RettBASE and curated to current modified ACMG/AMP criteria. Based on the classification scheme defined by the ClinGen Rett/Angelman-like Expert Panel for Rett/AS-like Disorders Specifications to the ACMG/AMP Variant Interpretation Guidelines VCEP 3.0, this variant is classified as likely pathogenic. At least the following criteria are met: Predicted to result in loss of function, and LOF is a known mechanism of disease (PVS1). This variant is absent from gnomAD (PM2_Supporting). - |
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at