X-154031053-C-CCTCAGCTTTTCGCTTCCTGCCGGGG

Variant names:

• chrX-154031053-C-CCTCAGCTTTTCGCTTCCTGCCGGGG
• rs1064797104
• NM_001110792.2:c.786_810dupCCCCGGCAGGAAGCGAAAAGCTGAG

Variant summary

Our verdict is Likely pathogenic. The variant received 9 ACMG points: 9P and 0B. PVS1 PP5

The NM_001110792.2(MECP2):​c.786_810dupCCCCGGCAGGAAGCGAAAAGCTGAG​(p.Ala271ProfsTer8) variant causes a frameshift, stop gained change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars).

• Frequency: Genomes: not found (cov: 23)
• Consequence: MECP2 NM_001110792.2 frameshift, stop_gained
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: -0.522
• Publications: 0 publications found

Genes affected

MECP2 (HGNC:6990): (methyl-CpG binding protein 2) DNA methylation is the major modification of eukaryotic genomes and plays an essential role in mammalian development. Human proteins MECP2, MBD1, MBD2, MBD3, and MBD4 comprise a family of nuclear proteins related by the presence in each of a methyl-CpG binding domain (MBD). Each of these proteins, with the exception of MBD3, is capable of binding specifically to methylated DNA. MECP2, MBD1 and MBD2 can also repress transcription from methylated gene promoters. In contrast to other MBD family members, MECP2 is X-linked and subject to X inactivation. MECP2 is dispensible in stem cells, but is essential for embryonic development. MECP2 gene mutations are the cause of most cases of Rett syndrome, a progressive neurologic developmental disorder and one of the most common causes of cognitive disability in females. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2015]

MECP2 Gene-Disease associations (from GenCC):

• chromosome Xq28 duplication syndrome

  Inheritance: XL Classification: DEFINITIVE Submitted by: G2P
• Rett syndrome

  Inheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), Ambry Genetics, ClinGen, G2P
• severe neonatal-onset encephalopathy with microcephaly

  Inheritance: XL Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, Orphanet
• syndromic X-linked intellectual disability Lubs type

  Inheritance: XL Classification: DEFINITIVE Submitted by: G2P
• atypical Rett syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• non-syndromic X-linked intellectual disability

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
• X-linked intellectual disability-psychosis-macroorchidism syndrome

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
• systemic lupus erythematosus

  Inheritance: Unknown Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Likely_pathogenic. The variant received 9 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. There are 413 pathogenic variants in the truncated region.
• PP5: Variant X-154031053-C-CCTCAGCTTTTCGCTTCCTGCCGGGG is Pathogenic according to our data. Variant chrX-154031053-C-CCTCAGCTTTTCGCTTCCTGCCGGGG is described in ClinVar as Pathogenic. ClinVar VariationId is 424884.Status of the report is no_assertion_criteria_provided, 0 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001110792.2. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MECP2	NM_001110792.2	MANE Select	c.786_810dupCCCCGGCAGGAAGCGAAAAGCTGAG	p.Ala271ProfsTer8	frameshift stop_gained	Exon 3 of 3	NP_001104262.1
	MECP2	NM_004992.4	MANE Plus Clinical	c.750_774dupCCCCGGCAGGAAGCGAAAAGCTGAG	p.Ala259ProfsTer8	frameshift stop_gained	Exon 4 of 4	NP_004983.1
	MECP2	NM_001316337.2		c.471_495dupCCCCGGCAGGAAGCGAAAAGCTGAG	p.Ala166ProfsTer8	frameshift stop_gained	Exon 5 of 5	NP_001303266.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	MECP2	ENST00000453960.7	TSL:1 MANE Select	c.786_810dupCCCCGGCAGGAAGCGAAAAGCTGAG	p.Ala271ProfsTer8	frameshift stop_gained	Exon 3 of 3	ENSP00000395535.2
	MECP2	ENST00000303391.11	TSL:1 MANE Plus Clinical	c.750_774dupCCCCGGCAGGAAGCGAAAAGCTGAG	p.Ala259ProfsTer8	frameshift stop_gained	Exon 4 of 4	ENSP00000301948.6
	MECP2	ENST00000630151.3	TSL:5	c.750_774dupCCCCGGCAGGAAGCGAAAAGCTGAG	p.Ala259ProfsTer8	frameshift stop_gained	Exon 4 of 4	ENSP00000486089.2

Frequencies

GnomAD3 genomes Cov.: 23

GnomAD4 exome Cov.: 35

GnomAD4 genome Cov.: 23

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

Rett syndrome Pathogenic:1

Oct 07, 2016

Molecular Genetics Laboratory, BC Children's and BC Women's Hospitals

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: clinical testing

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		-0.52
Mutation Taster		=1/199	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1064797104; hg19: chrX-153296504;