rs1064797104

Variant summary

Our verdict is Likely pathogenic. The variant received 9 ACMG points: 9P and 0B. PVS1PP5

The NM_001110792.2(MECP2):​c.786_810dupCCCCGGCAGGAAGCGAAAAGCTGAG​(p.Ala271ProfsTer8) variant causes a frameshift, stop gained change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars).

Frequency

Genomes: not found (cov: 23)

Consequence

MECP2
NM_001110792.2 frameshift, stop_gained

Scores

Not classified

Clinical Significance

Pathogenic no assertion criteria provided P:1

Conservation

PhyloP100: -0.522

Publications

0 publications found
Variant links:
Genes affected
MECP2 (HGNC:6990): (methyl-CpG binding protein 2) DNA methylation is the major modification of eukaryotic genomes and plays an essential role in mammalian development. Human proteins MECP2, MBD1, MBD2, MBD3, and MBD4 comprise a family of nuclear proteins related by the presence in each of a methyl-CpG binding domain (MBD). Each of these proteins, with the exception of MBD3, is capable of binding specifically to methylated DNA. MECP2, MBD1 and MBD2 can also repress transcription from methylated gene promoters. In contrast to other MBD family members, MECP2 is X-linked and subject to X inactivation. MECP2 is dispensible in stem cells, but is essential for embryonic development. MECP2 gene mutations are the cause of most cases of Rett syndrome, a progressive neurologic developmental disorder and one of the most common causes of cognitive disability in females. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2015]
MECP2 Gene-Disease associations (from GenCC):
  • chromosome Xq28 duplication syndrome
    Inheritance: XL Classification: DEFINITIVE Submitted by: G2P
  • Rett syndrome
    Inheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), Ambry Genetics, ClinGen, G2P
  • severe neonatal-onset encephalopathy with microcephaly
    Inheritance: XL Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, Orphanet
  • syndromic X-linked intellectual disability Lubs type
    Inheritance: XL Classification: DEFINITIVE Submitted by: G2P
  • atypical Rett syndrome
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
  • non-syndromic X-linked intellectual disability
    Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
  • X-linked intellectual disability-psychosis-macroorchidism syndrome
    Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
  • systemic lupus erythematosus
    Inheritance: Unknown Classification: SUPPORTIVE Submitted by: Orphanet

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Likely_pathogenic. The variant received 9 ACMG points.

PVS1
Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. There are 413 pathogenic variants in the truncated region.
PP5
Variant X-154031053-C-CCTCAGCTTTTCGCTTCCTGCCGGGG is Pathogenic according to our data. Variant chrX-154031053-C-CCTCAGCTTTTCGCTTCCTGCCGGGG is described in ClinVar as Pathogenic. ClinVar VariationId is 424884.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
MECP2NM_001110792.2 linkc.786_810dupCCCCGGCAGGAAGCGAAAAGCTGAG p.Ala271ProfsTer8 frameshift_variant, stop_gained Exon 3 of 3 ENST00000453960.7 NP_001104262.1
MECP2NM_004992.4 linkc.750_774dupCCCCGGCAGGAAGCGAAAAGCTGAG p.Ala259ProfsTer8 frameshift_variant, stop_gained Exon 4 of 4 ENST00000303391.11 NP_004983.1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
MECP2ENST00000453960.7 linkc.786_810dupCCCCGGCAGGAAGCGAAAAGCTGAG p.Ala271ProfsTer8 frameshift_variant, stop_gained Exon 3 of 3 1 NM_001110792.2 ENSP00000395535.2
MECP2ENST00000303391.11 linkc.750_774dupCCCCGGCAGGAAGCGAAAAGCTGAG p.Ala259ProfsTer8 frameshift_variant, stop_gained Exon 4 of 4 1 NM_004992.4 ENSP00000301948.6

Frequencies

GnomAD3 genomes
Cov.:
23
GnomAD4 exome
Cov.:
35
GnomAD4 genome
Cov.:
23

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: no assertion criteria provided
LINK: link

Submissions by phenotype

Rett syndrome Pathogenic:1
Oct 07, 2016
Molecular Genetics Laboratory, BC Children's and BC Women's Hospitals
Significance:Pathogenic
Review Status:no assertion criteria provided
Collection Method:clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
-0.52
Mutation Taster
=1/199
disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs1064797104; hg19: chrX-153296504; API