X-154379314-CGTGACGCGACAACGATTCGGCT-CGTGACGCGACAACGATTCGGCTGTGACGCGACAACGATTCGGCT

Variant names:

• chrX-154379314-C-CGTGACGCGACAACGATTCGGCT
• rs1463296648
• NM_000117.3:c.-139_-118dupCAACGATTCGGCTGTGACGCGA

Variant summary

Our verdict is Benign. The variant received -8 ACMG points: 0P and 8B. BS1 BS2

The NM_000117.3(EMD):​c.-139_-118dupCAACGATTCGGCTGTGACGCGA variant causes a 5 prime UTR change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000328 in 487,760 control chromosomes in the GnomAD database, with no homozygous occurrence. There are 4 hemizygotes in GnomAD. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.000044 (0 hom., 2 hem., cov: 26)
  • Exomes 𝑓: 0.000029 (0 hom. 2 hem.)
• Consequence: EMD NM_000117.3 5_prime_UTR
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 1.28
• Publications: 0 publications found

Genes affected

EMD (HGNC:3331): (emerin) Emerin is a serine-rich nuclear membrane protein and a member of the nuclear lamina-associated protein family. It mediates membrane anchorage to the cytoskeleton. Dreifuss-Emery muscular dystrophy is an X-linked inherited degenerative myopathy resulting from mutation in the emerin gene. [provided by RefSeq, Jul 2008]

EMD Gene-Disease associations (from GenCC):

• X-linked Emery-Dreifuss muscular dystrophy

  Inheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Ambry Genetics, Labcorp Genetics (formerly Invitae)
• heart conduction disease

  Inheritance: XL Classification: STRONG Submitted by: Genomics England PanelApp

ACMG classification

Our verdict: Benign. The variant received -8 ACMG points.

• BS1: Variant frequency is greater than expected in population eas. GnomAd4 allele frequency = 0.000044 (5/113582) while in subpopulation EAS AF = 0.000279 (1/3582). AF 95% confidence interval is 0.0000427. There are 0 homozygotes in GnomAd4. There are 2 alleles in the male GnomAd4 subpopulation. Median coverage is 26. This position passed quality control check.
• BS2: High Hemizygotes in GnomAd4 at 2 XL gene

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
EMD	NM_000117.3	c.-139_-118dupCAACGATTCGGCTGTGACGCGA		5_prime_UTR_variant	Exon 1 of 6	ENST00000369842.9	NP_000108.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
EMD	ENST00000369842.9	c.-139_-118dupCAACGATTCGGCTGTGACGCGA		5_prime_UTR_variant	Exon 1 of 6	1	NM_000117.3	ENSP00000358857.4

Frequencies

GnomAD3 genomes AF: 0.0000440 AC: 5 AN: 113582 Hom.: 0 Cov.: 26

Gnomad AFR AF: 0.000127

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.000279

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.0000294 AC: 11 AN: 374178 Hom.: 0 Cov.: 6 AF XY: 0.0000175 AC XY: 2 AN XY: 114084

African (AFR) AF: 0.000261 AC: 2 AN: 7670

American (AMR) AF: 0.000104 AC: 1 AN: 9580

Ashkenazi Jewish (ASJ) AF: 0.000111 AC: 1 AN: 9035

East Asian (EAS) AF: 0.000155 AC: 3 AN: 19313

South Asian (SAS) AF: 0.00 AC: 0 AN: 25275

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 22817

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 1434

European-Non Finnish (NFE) AF: 0.0000155 AC: 4 AN: 258684

Other (OTH) AF: 0.00 AC: 0 AN: 20370

GnomAD4 genome AF: 0.0000440 AC: 5 AN: 113582 Hom.: 0 Cov.: 26 AF XY: 0.0000559 AC XY: 2 AN XY: 35762

African (AFR) AF: 0.000127 AC: 4 AN: 31378

American (AMR) AF: 0.00 AC: 0 AN: 10928

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 2655

East Asian (EAS) AF: 0.000279 AC: 1 AN: 3582

South Asian (SAS) AF: 0.00 AC: 0 AN: 2881

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 6361

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 237

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 53340

Other (OTH) AF: 0.00 AC: 0 AN: 1538

Alfa AF: 0.00 Hom.: 0

Bravo AF: 0.00000378

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1463296648; hg19: chrX-153607674;