rs1463296648

Variant names:

• chrX-154379314-CGTGACGCGACAACGATTCGGCT-C
• rs1463296648
• NM_000117.3:c.-139_-118delCAACGATTCGGCTGTGACGCGA

Your query was ambiguous. Multiple possible variants found:

• chrX-154379314-CGTGACGCGACAACGATTCGGCT-C
• chrX-154379314-CGTGACGCGACAACGATTCGGCT-CGTGACGCGACAACGATTCGGCTGTGACGCGACAACGATTCGGCT
• chrX-154379314-CGTGACGCGACAACGATTCGGCT-CGTGACGCGACAACGATTCGGCTGTGACGCGACAACGATTCGGCTGTGACGCGACAACGATTCGGCT

Variant summary

Our verdict is Benign. The variant received -16 ACMG points: 0P and 16B. BP6_Very_Strong BS1 BS2

The NM_000117.3(EMD):​c.-139_-118delCAACGATTCGGCTGTGACGCGA variant causes a 5 prime UTR change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000211 in 487,802 control chromosomes in the GnomAD database, with no homozygous occurrence. There are 33 hemizygotes in GnomAD. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★★).

• Frequency:
  • Genomes: 𝑓 0.00011 (0 hom., 3 hem., cov: 26)
  • Exomes 𝑓: 0.00024 (0 hom. 30 hem.)
• Consequence: EMD NM_000117.3 5_prime_UTR
• Clinical Significance: Likely benign criteria provided, multiple submitters, no conflicts B:3
• Conservation: PhyloP100: 1.28
• Publications: 0 publications found

Genes affected

EMD (HGNC:3331): (emerin) Emerin is a serine-rich nuclear membrane protein and a member of the nuclear lamina-associated protein family. It mediates membrane anchorage to the cytoskeleton. Dreifuss-Emery muscular dystrophy is an X-linked inherited degenerative myopathy resulting from mutation in the emerin gene. [provided by RefSeq, Jul 2008]

EMD Gene-Disease associations (from GenCC):

• X-linked Emery-Dreifuss muscular dystrophy

  Inheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Ambry Genetics, Labcorp Genetics (formerly Invitae)
• heart conduction disease

  Inheritance: XL Classification: STRONG Submitted by: Genomics England PanelApp

ACMG classification

Our verdict: Benign. The variant received -16 ACMG points.

• BP6: Variant X-154379314-CGTGACGCGACAACGATTCGGCT-C is Benign according to our data. Variant chrX-154379314-CGTGACGCGACAACGATTCGGCT-C is described in ClinVar as [Likely_benign]. Clinvar id is 1215766.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BS1: Variant frequency is greater than expected in population eas. GnomAd4 allele frequency = 0.000114 (13/113626) while in subpopulation EAS AF = 0.000841 (3/3569). AF 95% confidence interval is 0.000228. There are 0 homozygotes in GnomAd4. There are 3 alleles in the male GnomAd4 subpopulation. Median coverage is 26. This position passed quality control check.
• BS2: High Hemizygotes in GnomAd4 at 3 XL gene

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
EMD	NM_000117.3	c.-139_-118delCAACGATTCGGCTGTGACGCGA		5_prime_UTR_variant	Exon 1 of 6	ENST00000369842.9	NP_000108.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
EMD	ENST00000369842.9	c.-139_-118delCAACGATTCGGCTGTGACGCGA		5_prime_UTR_variant	Exon 1 of 6	1	NM_000117.3	ENSP00000358857.4

Frequencies

GnomAD3 genomes AF: 0.000114 AC: 13 AN: 113578 Hom.: 0 Cov.: 26

Gnomad AFR AF: 0.000191

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.000838

Gnomad SAS AF: 0.000347

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000562

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.000241 AC: 90 AN: 374176 Hom.: 0 AF XY: 0.000263 AC XY: 30 AN XY: 114084

African (AFR) AF: 0.00 AC: 0 AN: 7668

American (AMR) AF: 0.000313 AC: 3 AN: 9580

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 9035

East Asian (EAS) AF: 0.000828 AC: 16 AN: 19313

South Asian (SAS) AF: 0.000356 AC: 9 AN: 25275

European-Finnish (FIN) AF: 0.000131 AC: 3 AN: 22817

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 1434

European-Non Finnish (NFE) AF: 0.000205 AC: 53 AN: 258684

Other (OTH) AF: 0.000295 AC: 6 AN: 20370

GnomAD4 genome AF: 0.000114 AC: 13 AN: 113626 Hom.: 0 Cov.: 26 AF XY: 0.0000838 AC XY: 3 AN XY: 35818

African (AFR) AF: 0.000191 AC: 6 AN: 31444

American (AMR) AF: 0.00 AC: 0 AN: 10940

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 2655

East Asian (EAS) AF: 0.000841 AC: 3 AN: 3569

South Asian (SAS) AF: 0.000348 AC: 1 AN: 2874

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 6361

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 214

European-Non Finnish (NFE) AF: 0.0000563 AC: 3 AN: 53331

Other (OTH) AF: 0.00 AC: 0 AN: 1556

Alfa AF: 0.00 Hom.: 0

Bravo AF: 0.000208

ClinVar

Significance: Likely benign

Submissions summary: Benign:3

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not provided Benign:1

Apr 14, 2020

GeneDx

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant is associated with the following publications: (PMID: 9536090, 9195226) -

X-linked Emery-Dreifuss muscular dystrophy Benign:1

Nov 17, 2022

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

EMD-related disorder Benign:1

Jun 26, 2023

PreventionGenetics, part of Exact Sciences

Significance: Likely benign

Review Status: no assertion criteria provided

Collection Method: clinical testing

This variant is classified as likely benign based on ACMG/AMP sequence variant interpretation guidelines (Richards et al. 2015 PMID: 25741868, with internal and published modifications). -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.3
Mutation Taster		=296/4	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1463296648; hg19: chrX-153607674;