rs1463296648

Variant names:

• chrX-154379314-CGTGACGCGACAACGATTCGGCT-C
• rs1463296648
• NM_000117.3:c.-139_-118delCAACGATTCGGCTGTGACGCGA

Your query was ambiguous. Multiple possible variants found:

• chrX-154379314-CGTGACGCGACAACGATTCGGCT-C
• chrX-154379314-CGTGACGCGACAACGATTCGGCT-CGTGACGCGACAACGATTCGGCTGTGACGCGACAACGATTCGGCT
• chrX-154379314-CGTGACGCGACAACGATTCGGCT-CGTGACGCGACAACGATTCGGCTGTGACGCGACAACGATTCGGCTGTGACGCGACAACGATTCGGCT

Variant summary

Our verdict is Benign. Variant got -16 ACMG points: 0P and 16B. BP6_Very_Strong BS1 BS2

The NM_000117.3(EMD):​c.-139_-118delCAACGATTCGGCTGTGACGCGA variant causes a 5 prime UTR change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000211 in 487,802 control chromosomes in the GnomAD database, with no homozygous occurrence. There are 33 hemizygotes in GnomAD. Variant has been reported in ClinVar as Likely benign (★★).

• Frequency:
  • Genomes: 𝑓 0.00011 (0 hom., 3 hem., cov: 26)
  • Exomes 𝑓: 0.00024 (0 hom. 30 hem.)
• Consequence: EMD NM_000117.3 5_prime_UTR
• Clinical Significance: Likely benign criteria provided, multiple submitters, no conflicts B:3
• Conservation: PhyloP100: 1.28

Genes affected

EMD (HGNC:3331): (emerin) Emerin is a serine-rich nuclear membrane protein and a member of the nuclear lamina-associated protein family. It mediates membrane anchorage to the cytoskeleton. Dreifuss-Emery muscular dystrophy is an X-linked inherited degenerative myopathy resulting from mutation in the emerin gene. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Benign. Variant got -16 ACMG points.

• BP6: Variant X-154379314-CGTGACGCGACAACGATTCGGCT-C is Benign according to our data. Variant chrX-154379314-CGTGACGCGACAACGATTCGGCT-C is described in ClinVar as [Likely_benign]. Clinvar id is 1215766.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BS1: Variant frequency is greater than expected in population eas. gnomad4 allele frequency = 0.000114 (13/113626) while in subpopulation EAS AF= 0.000841 (3/3569). AF 95% confidence interval is 0.000228. There are 0 homozygotes in gnomad4. There are 3 alleles in male gnomad4 subpopulation. Median coverage is 26. This position pass quality control queck.
• BS2: High Hemizygotes in GnomAd4 at 3 XL gene

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
EMD	NM_000117.3	c.-139_-118delCAACGATTCGGCTGTGACGCGA		5_prime_UTR_variant	Exon 1 of 6	ENST00000369842.9	NP_000108.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
EMD	ENST00000369842	c.-139_-118delCAACGATTCGGCTGTGACGCGA		5_prime_UTR_variant	Exon 1 of 6	1	NM_000117.3	ENSP00000358857.4

Frequencies

GnomAD3 genomes AF: 0.000114 AC: 13 AN: 113578 Hom.: 0 Cov.: 26 AF XY: 0.0000839 AC XY: 3 AN XY: 35760

Gnomad AFR AF: 0.000191

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.000838

Gnomad SAS AF: 0.000347

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000562

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.000241 AC: 90 AN: 374176 Hom.: 0 AF XY: 0.000263 AC XY: 30 AN XY: 114084

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.000313

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.000828

Gnomad4 SAS exome AF: 0.000356

Gnomad4 FIN exome AF: 0.000131

Gnomad4 NFE exome AF: 0.000205

Gnomad4 OTH exome AF: 0.000295

GnomAD4 genome AF: 0.000114 AC: 13 AN: 113626 Hom.: 0 Cov.: 26 AF XY: 0.0000838 AC XY: 3 AN XY: 35818

Gnomad4 AFR AF: 0.000191

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.000841

Gnomad4 SAS AF: 0.000348

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.0000563

Gnomad4 OTH AF: 0.00

Bravo AF: 0.000208

ClinVar

Significance: Likely benign

Submissions summary: Benign:3

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not provided Benign:1

Apr 14, 2020

GeneDx

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant is associated with the following publications: (PMID: 9536090, 9195226) -

X-linked Emery-Dreifuss muscular dystrophy Benign:1

Nov 17, 2022

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

EMD-related disorder Benign:1

Jun 26, 2023

PreventionGenetics, part of Exact Sciences

Significance: Likely benign

Review Status: no assertion criteria provided

Collection Method: clinical testing

This variant is classified as likely benign based on ACMG/AMP sequence variant interpretation guidelines (Richards et al. 2015 PMID: 25741868, with internal and published modifications). -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1463296648; hg19: chrX-153607674;