X-17376059-A-AGGCGGCGCCCGCAGCCGGCGAGGCGTCCTCGGCGGC
Variant summary
Our verdict is Likely benign. The variant received -1 ACMG points: 0P and 1B. BP3
The NM_001291867.2(NHS):c.310_345dupCCCGCAGCCGGCGAGGCGTCCTCGGCGGCGGCGGCG(p.Pro104_Ala115dup) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000904 in 110,643 control chromosomes in the GnomAD database, with no homozygous occurrence. There are no hemizygote samples in GnomAD. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
NM_001291867.2 conservative_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
- Nance-Horan syndromeInheritance: XL Classification: DEFINITIVE, STRONG, MODERATE, SUPPORTIVE Submitted by: ClinGen, Orphanet, G2P, Labcorp Genetics (formerly Invitae), Ambry Genetics
- early-onset nuclear cataractInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -1 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001291867.2. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| NHS | NM_001291867.2 | MANE Select | c.310_345dupCCCGCAGCCGGCGAGGCGTCCTCGGCGGCGGCGGCG | p.Pro104_Ala115dup | conservative_inframe_insertion | Exon 1 of 9 | NP_001278796.1 | ||
| NHS | NM_198270.4 | c.310_345dupCCCGCAGCCGGCGAGGCGTCCTCGGCGGCGGCGGCG | p.Pro104_Ala115dup | conservative_inframe_insertion | Exon 1 of 8 | NP_938011.1 |
Ensembl Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| NHS | ENST00000676302.1 | MANE Select | c.310_345dupCCCGCAGCCGGCGAGGCGTCCTCGGCGGCGGCGGCG | p.Pro104_Ala115dup | conservative_inframe_insertion | Exon 1 of 9 | ENSP00000502262.1 | ||
| NHS | ENST00000380060.7 | TSL:1 | c.310_345dupCCCGCAGCCGGCGAGGCGTCCTCGGCGGCGGCGGCG | p.Pro104_Ala115dup | conservative_inframe_insertion | Exon 1 of 8 | ENSP00000369400.3 |
Frequencies
GnomAD3 genomes AF: 0.00000904 AC: 1AN: 110643Hom.: 0 Cov.: 23 show subpopulations
GnomAD4 exome Data not reliable, filtered out with message: AC0 AF: 0.00 AC: 0AN: 943530Hom.: 0 Cov.: 30 AF XY: 0.00 AC XY: 0AN XY: 298554
GnomAD4 genome AF: 0.00000904 AC: 1AN: 110643Hom.: 0 Cov.: 23 AF XY: 0.00 AC XY: 0AN XY: 33327 show subpopulations
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at