rs797045741

Variant names:

• chrX-17376059-AGGCGGCGCCCGCAGCCGGCGAGGCGTCCTCGGCGGC-A
• rs797045741
• NM_001291867.2:c.310_345delCCCGCAGCCGGCGAGGCGTCCTCGGCGGCGGCGGCG

Your query was ambiguous. Multiple possible variants found:

• chrX-17376059-AGGCGGCGCCCGCAGCCGGCGAGGCGTCCTCGGCGGC-A
• chrX-17376059-AGGCGGCGCCCGCAGCCGGCGAGGCGTCCTCGGCGGC-AGGCGGCGCCCGCAGCCGGCGAGGCGTCCTCGGCGGCGGCGGCGCCCGCAGCCGGCGAGGCGTCCTCGGCGGC

Variant summary

Our verdict is Benign. Variant got -12 ACMG points: 0P and 12B. BP6_Very_Strong BS2

The NM_001291867.2(NHS):​c.310_345delCCCGCAGCCGGCGAGGCGTCCTCGGCGGCGGCGGCG​(p.Pro104_Ala115del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00128 in 1,054,192 control chromosomes in the GnomAD database, including 7 homozygotes. There are 393 hemizygotes in GnomAD. Variant has been reported in ClinVar as Benign (★★).

• Frequency:
  • Genomes: 𝑓 0.0021 (1 hom., 66 hem., cov: 23)
  • Exomes 𝑓: 0.0012 (6 hom. 327 hem.)
• Consequence: NHS NM_001291867.2 conservative_inframe_deletion
• Clinical Significance: Benign criteria provided, multiple submitters, no conflicts B:3
• Conservation: PhyloP100: 3.11

Genes affected

NHS (HGNC:7820): (NHS actin remodeling regulator) This gene encodes a protein containing four conserved nuclear localization signals. The encoded protein functions in eye, tooth, craniofacial and brain development, and it can regulate actin remodeling and cell morphology. Mutations in this gene have been shown to cause Nance-Horan syndrome, and also X-linked cataract-40. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, May 2014]

ACMG classification

Verdict is Benign. Variant got -12 ACMG points.

• BP6: Variant X-17376059-AGGCGGCGCCCGCAGCCGGCGAGGCGTCCTCGGCGGC-A is Benign according to our data. Variant chrX-17376059-AGGCGGCGCCCGCAGCCGGCGAGGCGTCCTCGGCGGC-A is described in ClinVar as [Benign]. Clinvar id is 211598.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars. Variant chrX-17376059-AGGCGGCGCCCGCAGCCGGCGAGGCGTCCTCGGCGGC-A is described in Lovd as [Benign].
• BS2: High Hemizygotes in GnomAd4 at 66 XL gene

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
NHS	NM_001291867.2	c.310_345delCCCGCAGCCGGCGAGGCGTCCTCGGCGGCGGCGGCG	p.Pro104_Ala115del	conservative_inframe_deletion	Exon 1 of 9	ENST00000676302.1	NP_001278796.1
NHS	NM_198270.4	c.310_345delCCCGCAGCCGGCGAGGCGTCCTCGGCGGCGGCGGCG	p.Pro104_Ala115del	conservative_inframe_deletion	Exon 1 of 8		NP_938011.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
NHS	ENST00000676302.1	c.310_345delCCCGCAGCCGGCGAGGCGTCCTCGGCGGCGGCGGCG	p.Pro104_Ala115del	conservative_inframe_deletion	Exon 1 of 9		NM_001291867.2	ENSP00000502262.1
NHS	ENST00000380060.7	c.310_345delCCCGCAGCCGGCGAGGCGTCCTCGGCGGCGGCGGCG	p.Pro104_Ala115del	conservative_inframe_deletion	Exon 1 of 8	1		ENSP00000369400.3

Frequencies

GnomAD3 genomes AF: 0.00213 AC: 236 AN: 110635 Hom.: 1 Cov.: 23 AF XY: 0.00195 AC XY: 65 AN XY: 33323

Gnomad AFR AF: 0.00501

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00273

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00349

Gnomad SAS AF: 0.000752

Gnomad FIN AF: 0.000345

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000628

Gnomad OTH AF: 0.00337

GnomAD3 exomes AF: 0.00540 AC: 112 AN: 20722 Hom.: 3 AF XY: 0.00711 AC XY: 36 AN XY: 5060

Gnomad AFR exome AF: 0.0370

Gnomad AMR exome AF: 0.00588

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.0400

Gnomad SAS exome AF: 0.00533

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00265

Gnomad OTH exome AF: 0.00453

GnomAD4 exome AF: 0.00117 AC: 1108 AN: 943519 Hom.: 6 AF XY: 0.00110 AC XY: 327 AN XY: 298549

Gnomad4 AFR exome AF: 0.00745

Gnomad4 AMR exome AF: 0.00279

Gnomad4 ASJ exome AF: 0.000143

Gnomad4 EAS exome AF: 0.00320

Gnomad4 SAS exome AF: 0.00211

Gnomad4 FIN exome AF: 0.000465

Gnomad4 NFE exome AF: 0.000920

Gnomad4 OTH exome AF: 0.00124

GnomAD4 genome AF: 0.00214 AC: 237 AN: 110673 Hom.: 1 Cov.: 23 AF XY: 0.00198 AC XY: 66 AN XY: 33373

Gnomad4 AFR AF: 0.00506

Gnomad4 AMR AF: 0.00263

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00350

Gnomad4 SAS AF: 0.000754

Gnomad4 FIN AF: 0.000345

Gnomad4 NFE AF: 0.000628

Gnomad4 OTH AF: 0.00333

Alfa AF: 0.00169 Hom.: 12

Bravo AF: 0.00260

ClinVar

Significance: Benign

Submissions summary: Benign:3

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not specified Benign:1

Aug 17, 2017

Genetic Services Laboratory, University of Chicago

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Inborn genetic diseases Benign:1

Sep 21, 2017

Ambry Genetics

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This alteration is classified as benign based on a combination of the following: seen in unaffected individuals, population frequency, intact protein function, lack of segregation with disease, co-occurrence, RNA analysis, in silico models, amino acid conservation, lack of disease association in case-control studies, and/or the mechanism of disease or impacted region is inconsistent with a known cause of pathogenicity. -

Nance-Horan syndrome Benign:1

Jan 30, 2025

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs797045741; hg19: chrX-17394182;