X-17376059-AGGCGGCGCCCGCAGCCGGCGAGGCGTCCTCGGCGGC-A

Variant names:

• chrX-17376059-AGGCGGCGCCCGCAGCCGGCGAGGCGTCCTCGGCGGC-A
• rs797045741
• NM_001291867.2:c.310_345delCCCGCAGCCGGCGAGGCGTCCTCGGCGGCGGCGGCG

Variant summary

Our verdict is Benign. The variant received -13 ACMG points: 0P and 13B. BP3 BP6_Very_Strong BS2

The NM_001291867.2(NHS):​c.310_345delCCCGCAGCCGGCGAGGCGTCCTCGGCGGCGGCGGCG​(p.Pro104_Ala115del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00128 in 1,054,192 control chromosomes in the GnomAD database, including 7 homozygotes. There are 393 hemizygotes in GnomAD. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Benign (★★).

• Frequency:
  • Genomes: 𝑓 0.0021 (1 hom., 66 hem., cov: 23)
  • Exomes 𝑓: 0.0012 (6 hom. 327 hem.)
• Consequence: NHS NM_001291867.2 conservative_inframe_deletion
• Clinical Significance: Benign criteria provided, multiple submitters, no conflicts B:3
• Conservation: PhyloP100: 3.11
• Publications: 0 publications found

Genes affected

NHS (HGNC:7820): (NHS actin remodeling regulator) This gene encodes a protein containing four conserved nuclear localization signals. The encoded protein functions in eye, tooth, craniofacial and brain development, and it can regulate actin remodeling and cell morphology. Mutations in this gene have been shown to cause Nance-Horan syndrome, and also X-linked cataract-40. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, May 2014]

NHS Gene-Disease associations (from GenCC):

• Nance-Horan syndrome

  Inheritance: XL Classification: DEFINITIVE, STRONG, MODERATE, SUPPORTIVE Submitted by: ClinGen, Orphanet, G2P, Labcorp Genetics (formerly Invitae), Ambry Genetics
• early-onset nuclear cataract

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Benign. The variant received -13 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_001291867.2
• BP6: Variant X-17376059-AGGCGGCGCCCGCAGCCGGCGAGGCGTCCTCGGCGGC-A is Benign according to our data. Variant chrX-17376059-AGGCGGCGCCCGCAGCCGGCGAGGCGTCCTCGGCGGC-A is described in ClinVar as Benign. ClinVar VariationId is 211598.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BS2: High AC in GnomAd4 at 237 XL,AD gene.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001291867.2. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	NHS	NM_001291867.2	MANE Select	c.310_345delCCCGCAGCCGGCGAGGCGTCCTCGGCGGCGGCGGCG	p.Pro104_Ala115del	conservative_inframe_deletion	Exon 1 of 9	NP_001278796.1
	NHS	NM_198270.4		c.310_345delCCCGCAGCCGGCGAGGCGTCCTCGGCGGCGGCGGCG	p.Pro104_Ala115del	conservative_inframe_deletion	Exon 1 of 8	NP_938011.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	NHS	ENST00000676302.1	MANE Select	c.310_345delCCCGCAGCCGGCGAGGCGTCCTCGGCGGCGGCGGCG	p.Pro104_Ala115del	conservative_inframe_deletion	Exon 1 of 9	ENSP00000502262.1
	NHS	ENST00000380060.7	TSL:1	c.310_345delCCCGCAGCCGGCGAGGCGTCCTCGGCGGCGGCGGCG	p.Pro104_Ala115del	conservative_inframe_deletion	Exon 1 of 8	ENSP00000369400.3

Frequencies

GnomAD3 genomes AF: 0.00213 AC: 236 AN: 110635 Hom.: 1 Cov.: 23

Gnomad AFR AF: 0.00501

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00273

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00349

Gnomad SAS AF: 0.000752

Gnomad FIN AF: 0.000345

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000628

Gnomad OTH AF: 0.00337

GnomAD2 exomes AF: 0.00540 AC: 112 AN: 20722 AF XY: 0.00711

Gnomad AFR exome AF: 0.0370

Gnomad AMR exome AF: 0.00588

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.0400

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00265

Gnomad OTH exome AF: 0.00453

GnomAD4 exome AF: 0.00117 AC: 1108 AN: 943519 Hom.: 6 AF XY: 0.00110 AC XY: 327 AN XY: 298549

African (AFR) AF: 0.00745 AC: 145 AN: 19453

American (AMR) AF: 0.00279 AC: 32 AN: 11481

Ashkenazi Jewish (ASJ) AF: 0.000143 AC: 2 AN: 14012

East Asian (EAS) AF: 0.00320 AC: 69 AN: 21566

South Asian (SAS) AF: 0.00211 AC: 75 AN: 35616

European-Finnish (FIN) AF: 0.000465 AC: 11 AN: 23672

Middle Eastern (MID) AF: 0.00438 AC: 11 AN: 2509

European-Non Finnish (NFE) AF: 0.000920 AC: 714 AN: 775694

Other (OTH) AF: 0.00124 AC: 49 AN: 39516

GnomAD4 genome AF: 0.00214 AC: 237 AN: 110673 Hom.: 1 Cov.: 23 AF XY: 0.00198 AC XY: 66 AN XY: 33373

African (AFR) AF: 0.00506 AC: 155 AN: 30622

American (AMR) AF: 0.00263 AC: 28 AN: 10651

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 2617

East Asian (EAS) AF: 0.00350 AC: 12 AN: 3424

South Asian (SAS) AF: 0.000754 AC: 2 AN: 2651

European-Finnish (FIN) AF: 0.000345 AC: 2 AN: 5805

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 212

European-Non Finnish (NFE) AF: 0.000628 AC: 33 AN: 52515

Other (OTH) AF: 0.00333 AC: 5 AN: 1502

Alfa AF: 0.00169 Hom.: 12

Bravo AF: 0.00260

ClinVar

ClinVar submissions as Germline

Significance: Benign

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
-	-	1	Inborn genetic diseases (1)
-	-	1	Nance-Horan syndrome (1)
-	-	1	not specified (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		3.1
Mutation Taster		=198/2	polymorphism (auto)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs797045741; hg19: chrX-17394182; COSMIC: COSV66275284;