X-17376059-AGGCGGCGCCCGCAGCCGGCGAGGCGTCCTCGGCGGC-AGGCGGCGCCCGCAGCCGGCGAGGCGTCCTCGGCGGCGGCGGCGCCCGCAGCCGGCGAGGCGTCCTCGGCGGC

Position:

• chrX-17376059-AGGCGGCGCCCGCAGCCGGCGAGGCGTCCTCGGCGGC-AGGCGGCGCCCGCAGCCGGCGAGGCGTCCTCGGCGGCGGCGGCGCCCGCAGCCGGCGAGGCGTCCTCGGCGGC

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM2

The NM_001291867.2(NHS):​c.310_345dup​(p.Pro104_Ala115dup) variant causes a inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000904 in 110,643 control chromosomes in the GnomAD database, with no homozygous occurrence. There are no hemizygote samples in GnomAD. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.0000090 (0 hom., 0 hem., cov: 23)
  • Exomes 𝑓: 0.0 (0 hom. 0 hem.)
  • Failed GnomAD Quality Control
• Consequence: NHS NM_001291867.2 inframe_insertion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 2.62

Genes affected

NHS (HGNC:7820): (NHS actin remodeling regulator) This gene encodes a protein containing four conserved nuclear localization signals. The encoded protein functions in eye, tooth, craniofacial and brain development, and it can regulate actin remodeling and cell morphology. Mutations in this gene have been shown to cause Nance-Horan syndrome, and also X-linked cataract-40. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, May 2014]

ACMG classification

Verdict is Uncertain_significance. Variant got 2 ACMG points.

• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
NHS	NM_001291867.2	c.310_345dup	p.Pro104_Ala115dup	inframe_insertion	1/9	ENST00000676302.1	NP_001278796.1
NHS	NM_198270.4	c.310_345dup	p.Pro104_Ala115dup	inframe_insertion	1/8		NP_938011.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
NHS	ENST00000676302.1	c.310_345dup	p.Pro104_Ala115dup	inframe_insertion	1/9		NM_001291867.2	ENSP00000502262	P4
NHS	ENST00000380060.7	c.310_345dup	p.Pro104_Ala115dup	inframe_insertion	1/8	1		ENSP00000369400	A2

Frequencies

GnomAD3 genomes AF: 0.00000904 AC: 1 AN: 110643 Hom.: 0 Cov.: 23 AF XY: 0.00 AC XY: 0 AN XY: 33327

Gnomad AFR AF: 0.0000327

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AC0 AF: 0.00 AC: 0 AN: 943530 Hom.: 0 Cov.: 30 AF XY: 0.00 AC XY: 0 AN XY: 298554

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome AF: 0.00000904 AC: 1 AN: 110643 Hom.: 0 Cov.: 23 AF XY: 0.00 AC XY: 0 AN XY: 33327

Gnomad4 AFR AF: 0.0000327

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.00

Gnomad4 OTH AF: 0.00

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs797045741; hg19: chrX-17394182;