X-21967073-TTTATTTATTTATTTATTTAC-T

Position:

• chrX-21967073-TTTATTTATTTATTTATTTAC-T

Variant summary

Our verdict is Benign. Variant got -10 ACMG points: 0P and 10B. BP6_Moderate BA1

The NM_004595.5(SMS):​c.50-108_50-89delATTTACTTATTTATTTATTT variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.227 in 349,806 control chromosomes in the GnomAD database, including 6,045 homozygotes. There are 19,522 hemizygotes in GnomAD. Variant has been reported in ClinVar as Benign (★).

• Frequency:
  • Genomes: 𝑓 0.16 (928 hom., 3730 hem., cov: 16)
  • Exomes 𝑓: 0.25 (5117 hom. 15792 hem.)
• Consequence: SMS NM_004595.5 intron
• Clinical Significance: Benign criteria provided, single submitter B:1
• Conservation: PhyloP100: 1.43

Genes affected

SMS (HGNC:11123): (spermine synthase) This gene encodes a protein belonging to the spermidine/spermin synthase family and catalyzes the production of spermine from spermidine. Pseudogenes of this gene are located on chromosomes 1, 5, 6 and X. Mutations in this gene cause an X-linked intellectual disability called Snyder-Robinson Syndrome (SRS). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2017]

ACMG classification

Verdict is Benign. Variant got -10 ACMG points.

• BP6: Variant X-21967073-TTTATTTATTTATTTATTTAC-T is Benign according to our data. Variant chrX-21967073-TTTATTTATTTATTTATTTAC-T is described in ClinVar as [Benign]. Clinvar id is 1180100.Status of the report is criteria_provided_single_submitter, 1 stars.
• BA1: GnomAd4 highest subpopulation (NFE) allele frequency at 95% confidence interval = 0.19 is higher than 0.05.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
SMS	NM_004595.5	c.50-108_50-89delATTTACTTATTTATTTATTT		intron_variant		ENST00000404933.7	NP_004586.2
SMS	NM_001258423.2	c.50-108_50-89delATTTACTTATTTATTTATTT		intron_variant			NP_001245352.1
SMS	XM_005274582.3	c.-53-108_-53-89delATTTACTTATTTATTTATTT		intron_variant			XP_005274639.1
SMS	XM_011545568.3	c.-53-108_-53-89delATTTACTTATTTATTTATTT		intron_variant			XP_011543870.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
SMS	ENST00000404933.7	c.50-122_50-103delTTATTTATTTATTTATTTAC		intron_variant		1	NM_004595.5	ENSP00000385746.2
SMS	ENST00000457085.2	c.395-122_395-103delTTATTTATTTATTTATTTAC		intron_variant		5		ENSP00000407366.2
SMS	ENST00000379404.5	c.50-122_50-103delTTATTTATTTATTTATTTAC		intron_variant		3		ENSP00000368714.1
SMS	ENST00000478094.1	n.97-122_97-103delTTATTTATTTATTTATTTAC		intron_variant		4

Frequencies

GnomAD3 genomes AF: 0.165 AC: 14969 AN: 90846 Hom.: 928 Cov.: 16 AF XY: 0.169 AC XY: 3728 AN XY: 22078

Gnomad AFR AF: 0.139

Gnomad AMI AF: 0.220

Gnomad AMR AF: 0.127

Gnomad ASJ AF: 0.113

Gnomad EAS AF: 0.0210

Gnomad SAS AF: 0.0396

Gnomad FIN AF: 0.206

Gnomad MID AF: 0.121

Gnomad NFE AF: 0.194

Gnomad OTH AF: 0.161

GnomAD4 exome AF: 0.249 AC: 64612 AN: 258969 Hom.: 5117 AF XY: 0.331 AC XY: 15792 AN XY: 47683

Gnomad4 AFR exome AF: 0.159

Gnomad4 AMR exome AF: 0.163

Gnomad4 ASJ exome AF: 0.150

Gnomad4 EAS exome AF: 0.0422

Gnomad4 SAS exome AF: 0.114

Gnomad4 FIN exome AF: 0.272

Gnomad4 NFE exome AF: 0.268

Gnomad4 OTH exome AF: 0.232

GnomAD4 genome AF: 0.165 AC: 14963 AN: 90837 Hom.: 928 Cov.: 16 AF XY: 0.169 AC XY: 3730 AN XY: 22095

Gnomad4 AFR AF: 0.139

Gnomad4 AMR AF: 0.127

Gnomad4 ASJ AF: 0.113

Gnomad4 EAS AF: 0.0210

Gnomad4 SAS AF: 0.0393

Gnomad4 FIN AF: 0.206

Gnomad4 NFE AF: 0.194

Gnomad4 OTH AF: 0.159

Alfa AF: 0.160 Hom.: 787

Asia WGS AF: 0.0410 AC: 103 AN: 2443

ClinVar

Significance: Benign

Submissions summary: Benign:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Benign:1

Benign, criteria provided, single submitter

clinical testing

GeneDx

May 16, 2021

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs765255793; hg19: chrX-21985191;