X-24364256-TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC-TTGCTGCTGCTGC

Variant names:

• chrX-24364267-GCTGCTGCTGCTGCTGCTGCTGCTGCTG-G
• NM_001136234.3:c.1525_1551delGCTGCTGCTGCTGCTGCTGCTGCTGCT

Variant summary

Our verdict is Likely benign. The variant received -1 ACMG points: 0P and 1B. BP3

The NM_001136234.3(SUPT20HL1):​c.1525_1551delGCTGCTGCTGCTGCTGCTGCTGCTGCT​(p.Ala509_Ala517del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: not found (cov: 21)
• Consequence: SUPT20HL1 NM_001136234.3 conservative_inframe_deletion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.277
• Publications: 0 publications found

Genes affected

SUPT20HL1 (HGNC:30773): (SUPT20H like 1) Predicted to enable transcription coregulator activity. Predicted to be involved in regulation of transcription by RNA polymerase II. Predicted to be part of SAGA complex. [provided by Alliance of Genome Resources, Apr 2022]

ACMG classification

Our verdict: Likely_benign. The variant received -1 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_001136234.3

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001136234.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SUPT20HL1	NM_001136234.3	MANE Select	c.1525_1551delGCTGCTGCTGCTGCTGCTGCTGCTGCT	p.Ala509_Ala517del	conservative_inframe_deletion	Exon 1 of 1	NP_001129706.3	A0A7I2YQ69

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SUPT20HL1	ENST00000686983.1	MANE Select	c.1525_1551delGCTGCTGCTGCTGCTGCTGCTGCTGCT	p.Ala509_Ala517del	conservative_inframe_deletion	Exon 1 of 1	ENSP00000509731.1	A0A7I2YQ69
	SUPT20HL1	ENST00000436466.2	TSL:6	c.1525_1551delGCTGCTGCTGCTGCTGCTGCTGCTGCT	p.Ala509_Ala517del	conservative_inframe_deletion	Exon 2 of 2	ENSP00000502907.1	A0A7I2YQ69

Frequencies

GnomAD3 genomes Cov.: 21

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 21

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.28

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.

Other links and lift over

hg19: chrX-24382384;