X-24364256-TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC-TTGCTGCTGCTGC

Variant names:

• chrX-24364256-TTGCTGCTGCTGCTGCTGCTGCTGCTGC-T
• rs35206911
• NM_001136234.3:c.1525_1551delGCTGCTGCTGCTGCTGCTGCTGCTGCT

Variant summary

Our verdict is Likely benign. The variant received -5 ACMG points: 0P and 5B. BP3 BS2

The NM_001136234.3(SUPT20HL1):​c.1525_1551delGCTGCTGCTGCTGCTGCTGCTGCTGCT​(p.Ala509_Ala517del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00053 in 803,955 control chromosomes in the GnomAD database, with no homozygous occurrence. There are 125 hemizygotes in GnomAD. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.0014 (0 hom., 32 hem., cov: 2)
  • Exomes 𝑓: 0.00043 (0 hom. 93 hem.)
• Consequence: SUPT20HL1 NM_001136234.3 conservative_inframe_deletion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.439
• Publications: 1 publications found

Genes affected

SUPT20HL1 (HGNC:30773): (SUPT20H like 1) Predicted to enable transcription coregulator activity. Predicted to be involved in regulation of transcription by RNA polymerase II. Predicted to be part of SAGA complex. [provided by Alliance of Genome Resources, Apr 2022]

ACMG classification

Our verdict: Likely_benign. The variant received -5 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_001136234.3
• BS2: High Hemizygotes in GnomAd4 at 32 gene

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001136234.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SUPT20HL1	NM_001136234.3	MANE Select	c.1525_1551delGCTGCTGCTGCTGCTGCTGCTGCTGCT	p.Ala509_Ala517del	conservative_inframe_deletion	Exon 1 of 1	NP_001129706.3	A0A7I2YQ69

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SUPT20HL1	ENST00000686983.1	MANE Select	c.1525_1551delGCTGCTGCTGCTGCTGCTGCTGCTGCT	p.Ala509_Ala517del	conservative_inframe_deletion	Exon 1 of 1	ENSP00000509731.1	A0A7I2YQ69
	SUPT20HL1	ENST00000436466.2	TSL:6	c.1525_1551delGCTGCTGCTGCTGCTGCTGCTGCTGCT	p.Ala509_Ala517del	conservative_inframe_deletion	Exon 2 of 2	ENSP00000502907.1	A0A7I2YQ69

Frequencies

GnomAD3 genomes AF: 0.00145 AC: 119 AN: 82144 Hom.: 0 Cov.: 2

Gnomad AFR AF: 0.000693

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000767

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.000357

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.000239

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00219

Gnomad OTH AF: 0.000936

GnomAD4 exome AF: 0.000425 AC: 307 AN: 721803 Hom.: 0 AF XY: 0.000412 AC XY: 93 AN XY: 225473

African (AFR) AF: 0.000193 AC: 3 AN: 15565

American (AMR) AF: 0.000337 AC: 9 AN: 26742

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 15763

East Asian (EAS) AF: 0.00 AC: 0 AN: 24829

South Asian (SAS) AF: 0.0000967 AC: 4 AN: 41346

European-Finnish (FIN) AF: 0.000249 AC: 9 AN: 36140

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 3288

European-Non Finnish (NFE) AF: 0.000510 AC: 268 AN: 525488

Other (OTH) AF: 0.000429 AC: 14 AN: 32642

GnomAD4 genome AF: 0.00145 AC: 119 AN: 82152 Hom.: 0 Cov.: 2 AF XY: 0.00166 AC XY: 32 AN XY: 19302

African (AFR) AF: 0.000691 AC: 12 AN: 17360

American (AMR) AF: 0.000767 AC: 6 AN: 7825

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 2061

East Asian (EAS) AF: 0.000358 AC: 1 AN: 2792

South Asian (SAS) AF: 0.00 AC: 0 AN: 1373

European-Finnish (FIN) AF: 0.000239 AC: 1 AN: 4177

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 183

European-Non Finnish (NFE) AF: 0.00219 AC: 98 AN: 44731

Other (OTH) AF: 0.000923 AC: 1 AN: 1084

Alfa AF: 0.00 Hom.: 142

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.44

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs35206911; hg19: chrX-24382373;