X-25013530-GGCCGCGGCGGCCGCGGCCGCGGCT-GGCCGCGGCGGCCGCGGCCGCGGCTGCCGCGGCGGCCGCGGCCGCGGCT
Variant summary
Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PM4PP5_Very_Strong
The NM_139058.3(ARX):c.441_464dupAGCCGCGGCCGCGGCCGCCGCGGC(p.Ala148_Ala155dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000246 in 813,857 control chromosomes in the GnomAD database, with no homozygous occurrence. There are no hemizygote samples in GnomAD. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★).
Frequency
Consequence
NM_139058.3 disruptive_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
- genetic developmental and epileptic encephalopathyInheritance: AD, XL Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
- intellectual disability, X-linked, with or without seizures, ARX-relatedInheritance: XL Classification: DEFINITIVE, MODERATE Submitted by: Ambry Genetics, G2P
- Partington syndromeInheritance: XL Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, G2P
- X-linked complex neurodevelopmental disorderInheritance: XL Classification: DEFINITIVE Submitted by: ClinGen
- X-linked lissencephaly with abnormal genitaliaInheritance: XL Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), Genomics England PanelApp, Ambry Genetics
- infantile spasmsInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- corpus callosum agenesis-abnormal genitalia syndromeInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
- infantile epileptic-dyskinetic encephalopathyInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
- non-syndromic X-linked intellectual disabilityInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
- X-linked spasticity-intellectual disability-epilepsy syndromeInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 10 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_139058.3. You can select a different transcript below to see updated ACMG assignments.
Frequencies
GnomAD3 genomes AF: 0.00000955 AC: 1AN: 104668Hom.: 0 Cov.: 21 show subpopulations
GnomAD4 exome AF: 0.00000141 AC: 1AN: 709189Hom.: 0 Cov.: 30 AF XY: 0.00 AC XY: 0AN XY: 214631 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
Age Distribution
GnomAD4 genome AF: 0.00000955 AC: 1AN: 104668Hom.: 0 Cov.: 21 AF XY: 0.00 AC XY: 0AN XY: 29916 show subpopulations ⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5.
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at