X-25013543-GCGGCCGCGGCTGCCGCGGCGGCCC-GCGGCCGCGGCTGCCGCGGCGGCCCCGGCCGCGGCTGCCGCGGCGGCCC

Variant names:

• chrX-25013543-G-GCGGCCGCGGCTGCCGCGGCGGCCC
• rs387906493
• NM_139058.3:c.428_451dupGGGCCGCCGCGGCAGCCGCGGCCG

Variant summary

Our verdict is Uncertain significance. The variant received 3 ACMG points: 7P and 4B. PS3 PM4 PP5 BS2

The NM_139058.3(ARX):​c.428_451dupGGGCCGCCGCGGCAGCCGCGGCCG​(p.Gly143_Ala150dup) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000189 in 794,926 control chromosomes in the GnomAD database, with no homozygous occurrence. There are 2 hemizygotes in GnomAD. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars). ClinVar reports functional evidence for this variant: "SCV000829094: Studies have shown that this variant alters ARX gene expression (PMID:17331656).". Synonymous variant affecting the same amino acid position (i.e. A151A) has been classified as Likely benign.

• Frequency:
  • Genomes: 𝑓 0.000077 (0 hom., 0 hem., cov: 21)
  • Exomes 𝑓: 0.000010 (0 hom. 2 hem.)
• Consequence: ARX NM_139058.3 conservative_inframe_insertion
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications P:5 U:1
• Conservation: PhyloP100: 0.378
• Publications: 20 publications found

Genes affected

ARX (HGNC:18060): (aristaless related homeobox) This gene is a homeobox-containing gene expressed during development. The expressed protein contains two conserved domains, a C-peptide (or aristaless domain) and the prd-like class homeobox domain. It is a member of the group-II aristaless-related protein family whose members are expressed primarily in the central and/or peripheral nervous system. This gene is thought to be involved in CNS development. Expansion of a polyalanine tract and other mutations in this gene cause X-linked cognitive disability and epilepsy. [provided by RefSeq, Jul 2016]

ARX Gene-Disease associations (from GenCC):

• genetic developmental and epileptic encephalopathy

  Inheritance: AD, XL Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
• intellectual disability, X-linked, with or without seizures, ARX-related

  Inheritance: XL Classification: DEFINITIVE, MODERATE Submitted by: Ambry Genetics, G2P
• Partington syndrome

  Inheritance: XL Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, G2P
• X-linked complex neurodevelopmental disorder

  Inheritance: XL Classification: DEFINITIVE Submitted by: ClinGen
• X-linked lissencephaly with abnormal genitalia

  Inheritance: XL Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), Genomics England PanelApp, Ambry Genetics
• infantile spasms

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• corpus callosum agenesis-abnormal genitalia syndrome

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
• infantile epileptic-dyskinetic encephalopathy

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
• non-syndromic X-linked intellectual disability

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
• X-linked spasticity-intellectual disability-epilepsy syndrome

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 3 ACMG points.

• PS3: PS3 evidence extracted from ClinVar submissions: SCV000829094: Studies have shown that this variant alters ARX gene expression (PMID: 17331656).
• PM4: Nonframeshift variant in NON repetitive region in NM_139058.3.
• PP5: Variant X-25013543-G-GCGGCCGCGGCTGCCGCGGCGGCCC is Pathogenic according to our data. Variant chrX-25013543-G-GCGGCCGCGGCTGCCGCGGCGGCCC is described in ClinVar as Conflicting_classifications_of_pathogenicity. ClinVar VariationId is 11187.
• BS2: High AC in GnomAd4 at 8 XL,AD gene.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_139058.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ARX	NM_139058.3	MANE Select	c.428_451dupGGGCCGCCGCGGCAGCCGCGGCCG	p.Gly143_Ala150dup	conservative_inframe_insertion	Exon 2 of 5	NP_620689.1	Q96QS3

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ARX	ENST00000379044.5	TSL:1 MANE Select	c.428_451dupGGGCCGCCGCGGCAGCCGCGGCCG	p.Gly143_Ala150dup	conservative_inframe_insertion	Exon 2 of 5	ENSP00000368332.4	Q96QS3

Frequencies

GnomAD3 genomes AF: 0.0000767 AC: 8 AN: 104289 Hom.: 0 Cov.: 21

Gnomad AFR AF: 0.000237

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000200

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.0000101 AC: 7 AN: 690637 Hom.: 0 Cov.: 30 AF XY: 0.00000954 AC XY: 2 AN XY: 209747

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.000226 AC: 3 AN: 13291

American (AMR) AF: 0.00 AC: 0 AN: 2076

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 5137

East Asian (EAS) AF: 0.00 AC: 0 AN: 5297

South Asian (SAS) AF: 0.0000664 AC: 1 AN: 15058

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 4259

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 1292

European-Non Finnish (NFE) AF: 0.00000484 AC: 3 AN: 620414

Other (OTH) AF: 0.00 AC: 0 AN: 23813

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.0000767 AC: 8 AN: 104289 Hom.: 0 Cov.: 21 AF XY: 0.00 AC XY: 0 AN XY: 29767

African (AFR) AF: 0.000237 AC: 7 AN: 29549

American (AMR) AF: 0.00 AC: 0 AN: 10216

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 2546

East Asian (EAS) AF: 0.00 AC: 0 AN: 3238

South Asian (SAS) AF: 0.00 AC: 0 AN: 2468

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 3911

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 217

European-Non Finnish (NFE) AF: 0.0000200 AC: 1 AN: 50102

Other (OTH) AF: 0.00 AC: 0 AN: 1414

Alfa AF: 0.00 Hom.: 0

ClinVar

ClinVar submissions

Significance: Conflicting classifications of pathogenicity

Revision: criteria provided, conflicting classifications

Pathogenic	VUS	Benign	Condition
1	1	-	not provided (2)
1	-	-	Developmental and epileptic encephalopathy, 1 (1)
1	-	-	Intellectual disability, X-linked, with or without seizures, ARX-related (1)
1	-	-	Intellectual disability, X-linked, with or without seizures, ARX-related;C3463992:Developmental and epileptic encephalopathy, 1 (1)
1	-	-	Partington syndrome (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.38

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs387906493; hg19: chrX-25031660;