rs387906493

Variant names:

• chrX-25013543-GCGGCCGCGGCTGCCGCGGCGGCCC-G
• rs387906493
• NM_139058.3:c.428_451delGGGCCGCCGCGGCAGCCGCGGCCG

Your query was ambiguous. Multiple possible variants found:

• chrX-25013543-GCGGCCGCGGCTGCCGCGGCGGCCC-G
• chrX-25013543-GCGGCCGCGGCTGCCGCGGCGGCCC-GCGGCCGCGGCTGCCGCGGCGGCCCCGGCCGCGGCTGCCGCGGCGGCCC

Variant summary

Our verdict is Benign. The variant received -10 ACMG points: 2P and 12B. PM4 BP6_Very_Strong BS2

The NM_139058.3(ARX):​c.428_451delGGGCCGCCGCGGCAGCCGCGGCCG​(p.Gly143_Ala150del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000176 in 794,928 control chromosomes in the GnomAD database, with no homozygous occurrence. There are 4 hemizygotes in GnomAD. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★★).

• Frequency:
  • Genomes: 𝑓 0.0000096 (0 hom., 0 hem., cov: 21)
  • Exomes 𝑓: 0.000019 (0 hom. 4 hem.)
• Consequence: ARX NM_139058.3 disruptive_inframe_deletion
• Clinical Significance: Benign/Likely benign criteria provided, multiple submitters, no conflicts B:2
• Conservation: PhyloP100: 2.09
• Publications: 20 publications found

Genes affected

ARX (HGNC:18060): (aristaless related homeobox) This gene is a homeobox-containing gene expressed during development. The expressed protein contains two conserved domains, a C-peptide (or aristaless domain) and the prd-like class homeobox domain. It is a member of the group-II aristaless-related protein family whose members are expressed primarily in the central and/or peripheral nervous system. This gene is thought to be involved in CNS development. Expansion of a polyalanine tract and other mutations in this gene cause X-linked cognitive disability and epilepsy. [provided by RefSeq, Jul 2016]

ARX Gene-Disease associations (from GenCC):

• genetic developmental and epileptic encephalopathy

  Inheritance: AD, XL Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
• intellectual disability, X-linked, with or without seizures, ARX-related

  Inheritance: XL Classification: DEFINITIVE, MODERATE Submitted by: Ambry Genetics, G2P
• Partington syndrome

  Inheritance: XL Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, G2P
• X-linked complex neurodevelopmental disorder

  Inheritance: XL Classification: DEFINITIVE Submitted by: ClinGen
• X-linked lissencephaly with abnormal genitalia

  Inheritance: XL Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), Genomics England PanelApp, Ambry Genetics
• infantile spasms

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• corpus callosum agenesis-abnormal genitalia syndrome

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
• infantile epileptic-dyskinetic encephalopathy

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
• non-syndromic X-linked intellectual disability

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
• X-linked spasticity-intellectual disability-epilepsy syndrome

  Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Benign. The variant received -10 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_139058.3.
• BP6: Variant X-25013543-GCGGCCGCGGCTGCCGCGGCGGCCC-G is Benign according to our data. Variant chrX-25013543-GCGGCCGCGGCTGCCGCGGCGGCCC-G is described in ClinVar as Benign/Likely_benign. ClinVar VariationId is 1235070.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BS2: High AC in GnomAdExome4 at 13 XL,AD gene.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_139058.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ARX	NM_139058.3	MANE Select	c.428_451delGGGCCGCCGCGGCAGCCGCGGCCG	p.Gly143_Ala150del	disruptive_inframe_deletion	Exon 2 of 5	NP_620689.1	Q96QS3

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ARX	ENST00000379044.5	TSL:1 MANE Select	c.428_451delGGGCCGCCGCGGCAGCCGCGGCCG	p.Gly143_Ala150del	disruptive_inframe_deletion	Exon 2 of 5	ENSP00000368332.4	Q96QS3

Frequencies

GnomAD3 genomes AF: 0.00000959 AC: 1 AN: 104289 Hom.: 0 Cov.: 21

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000200

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.0000188 AC: 13 AN: 690639 Hom.: 0 AF XY: 0.0000191 AC XY: 4 AN XY: 209747

African (AFR) AF: 0.00 AC: 0 AN: 13291

American (AMR) AF: 0.00 AC: 0 AN: 2076

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 5137

East Asian (EAS) AF: 0.00 AC: 0 AN: 5297

South Asian (SAS) AF: 0.00 AC: 0 AN: 15060

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 4259

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 1292

European-Non Finnish (NFE) AF: 0.0000210 AC: 13 AN: 620414

Other (OTH) AF: 0.00 AC: 0 AN: 23813

GnomAD4 genome AF: 0.00000959 AC: 1 AN: 104289 Hom.: 0 Cov.: 21 AF XY: 0.00 AC XY: 0 AN XY: 29767

African (AFR) AF: 0.00 AC: 0 AN: 29549

American (AMR) AF: 0.00 AC: 0 AN: 10216

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 2546

East Asian (EAS) AF: 0.00 AC: 0 AN: 3238

South Asian (SAS) AF: 0.00 AC: 0 AN: 2468

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 3911

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 217

European-Non Finnish (NFE) AF: 0.0000200 AC: 1 AN: 50102

Other (OTH) AF: 0.00 AC: 0 AN: 1414

Alfa AF: 0.00 Hom.: 0

Bravo AF: 0.0000189

ClinVar

ClinVar submissions

Significance: Benign/Likely benign

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
-	-	1	Intellectual disability, X-linked, with or without seizures, ARX-related;C3463992:Developmental and epileptic encephalopathy, 1 (1)
-	-	1	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.1

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs387906493; hg19: chrX-25031660;